Singlet7812

Singlet7812

 

LEFL1070BB01

 

642

 

AA824672

 

358

 

238

 

3.00E-62

 

120

 

100

 

642

 

AY344492|Os05g0530400 Heat shock factor protein 1 (HSF 1) (Heat shock transcription factor 1) (HSTF 1).

 

459

 

172

 

2.00E-43

 

103

 

75

 

642

 

dbj|BAA83711.1| heat shock factor [Nicotiana tabacum]

 

408

 

240

 

4.00E-62

 

119

 

91

 

642

 

SGN-U329730

 

2019

 

289

 

1.00E-77

 

360

 

85

 

642

 

O49403|HFA4A_ARATH Heat stress transcription factor A-4a (AtHsfA4a) (Heat shock factor protein 21) (HSF 21) (Heat shock transcription factor 21) (HSTF 21) - Arabidopsis thaliana (Mouse-ear cress)

 

401

 

192

 

1.00E-48

 

117

 

76

 

642

 

AT4G18880.1 | Symbol: None | heat shock transcription factor 21 (HSF21), identical to heat shock transcription factor 21 (Arabidopsis thaliana) GI:3399765: contains Pfam profile: PF00447 HSF-type DNA-binding domain | chr4:10347593-10349573 REVERSE | Aliases: F13C5.50, F13C5_50

 

401

 

192

 

2.00E-49

 

117

 

76

 

CCATTTGAGCAAGTAGTCTCTAGTGTGGGGTTCTGGAAACAAGCATGTAGTCTGTGATCAGGTGAGATTTGCTTGAATTTGATTGTAACGCAGCGAGATCTAGCTCATTACGATCCTTACGAGGAGTTTTCTGGAGTGTGATGATAAGAAGTTTTGCTCTTAGTAGATGTTCTGTTTCGTTGTTTTAGTTTAGGGGTTGTGATTTTCGTTGAAACCTATCATGGATGAAGCTTCGTGCAGCACGAATGCACTGCCTCCTTTTATTGCAAAGACATATGAAATGGTGGATGATCCATCCTGTGATGCTATTGTCTCCTGGAGTTCGAATAATAAAAGCTTCATTGTGTGGAATCCTCCAGATTTTGCAAGAGATTTGTTGCCTAGATACTTCAAGCACAATAATTTTTCCAGCTTTATCAGACAACTAAACACTTATGGATTCAGGAAAATTGACCCTGAAAAATGGGAGTTCGCGAATGAAGGTAATTTCATTAGAGGTCAGCCGAACCTTTTGAAGAATATCCATAGGCGTAAACCTGTTCATAGTCATTCTGCACAGAATCTTCATGGCCTGTCATC

 

579

 

7812