Singlet44

Singlet44

 

FA04BC02

 

341

 

TC179807 similar to UP|Q53PZ7_ORYSA (Q53PZ7) Cytochrome P450, partial (21%)

 

528

 

672

 

0

 

339

 

100

 

341

 

AK106404|Os11g0151400 Cytochrome P450 family protein.

 

520

 

156

 

4.00E-39

 

98

 

67

 

341

 

gb|ABC59093.1| cytochrome P450 monooxygenase CYP94C9 [Medicago truncatula]

 

517

 

162

 

5.00E-39

 

112

 

64

 

341

 

SGN-U316811

 

1573

 

672

 

0

 

339

 

100

 

341

 

O23066|C86A2_ARATH Cytochrome P450 86A2 (EC 1.14.-.-) - Arabidopsis thaliana (Mouse-ear cress)

 

553

 

82

 

7.00E-16

 

54

 

62

 

341

 

AT2G27690.1 | Symbol: None | cytochrome P450, putative, similar to Cytochrome P450 94A1 (P450-dependent fatty acid omega-hydroxylase) (SP:O81117) {Vicia sativa}: contains Pfam profile: PF00067 cytochrome P450: supported by cDNA: gi_13877668 | chr2:11816383-11818292 FORWARD | Aliases: F15K20.21, F15K20_21

 

495

 

159

 

3.00E-40

 

111

 

64

 

CCTCTTCTTATTTCTCCTTTGTTATTTTGTTAGACTAAAGTTTTTATGCAAATGTGAAATTTGTCAATGTTACATGACATCAAGTTGGTACCCTCAATTCACTAATTTGTGTGATTGGTATACTCATCTTCTTAAAAAATCCCCTACTAGAACCATACACATCCATGTTCTTGGTAACACCATCACCGCGAACCCTAAAAATGTCGAATACATGCTCAAAACAAGATTTGATAATTTTCCAAAAGGGAAGAATTTCTCAACAATCTTAGGTGATTTTCTTGGTAAAGGTATCTTCAATGTGGATGGAGATTTATGGAGATTTCAAAGGAAAATGGCTAGTC

 

341

 

44