Singlet40

Singlet40

 

FA04BA06

 

530

 

BP876237

 

476

 

944

 

0

 

476

 

100

 

530

 

AK121013|Os01g0235700 Basic helix-loop-helix dimerisation region bHLH domain containing protein.

 

617

 

88

 

3.00E-18

 

151

 

35

 

530

 

gb|AAM10932.1|AF488559_1 putative bHLH transcription factor [Arabidopsis thaliana]

 

590

 

120

 

3.00E-26

 

183

 

44

 

530

 

SGN-U319617

 

1579

 

946

 

0

 

477

 

100

 

530

 

Q9CAD0|EGL1_ARATH Transcription factor EGL1 (ENHANCER OF GLABRA3) (Basic helix-loop-helix protein 2) (bHLH 2) (AtbHLH002) (AtMyc-146) - Arabidopsis thaliana (Mouse-ear cress)

 

596

 

59

 

1.00E-08

 

73

 

38

 

530

 

AT1G01260.1 | Symbol: None | basic helix-loop-helix (bHLH) family protein, contains Pfam profile: PF00010 helix-loop-helix DNA-binding domain | chr1:109032-111609 FORWARD | Aliases: F6F3.7, F6F3_7

 

590

 

120

 

5.00E-28

 

183

 

44

 

GATGAGAGGGAGGTCCCGGGAAGTGTTTTGGATCAGGTAAGTATTTGTGGTTATCAGATGCATTGACATCTAATCTAGATTATTGTGCTAGATCTTTCTTAGCTAAGTCTGCTGGTATGCAAACTATTGCTTTGATTCCAACTGATGTAGGAGTTGTGGAATTGGGGTCAGTGAGATCGATACCGGAGAGTTTAGAGCTATTACAGAATATAAAATCTTGCTTCTCGTCGTTTTTATCACTTGTTAGGGATAAGCAAGCAGCAGGTATAGCAGCTGTACCTGAGAAAAACGAGGGAAACAATCCCCGCCTTTCCAACTCTGGCGCTGTTACTGAACGAACAGATGGAAATCCTAAGATATTTGGGCATGATTTGAATTCTGGTACTCACTTTAGGGAAAAACTTGCTGTTAGGAAAGCGGAGGAGAGGCCATGGGACATGTACCAAAATGGTAACAGGATGCCATTTGTGAACGCACGGAA

 

481

 

40