FC05CH08

FC05CH08

 

1

 

ORF1

 

51BF534348DF436A

 

218

 

IPR000504

 

SEQUENCE: FC05CH08_1_ORF1CRC64: 51BF534348DF436ALENGTH: 218 aa
InterPro
IPR000504
Domain
RNA-binding region RNP-1 (RNA recognition motif)
PF00076[51-122]T 1.5e-21 PF00076 RRM_1RRM_1
SM00360[50-123]T 2.2e-23 SM00360 no descriptionno description
PS50102[49-127]T 17.063 PS50102 RRMRRM
noIPR
unintegrated
unintegrated
G3D.3.30.70.330[33-133]T 4.2e-23 G3D.3.30.70.330 no descriptionno description
PTHR15241[45-218]T 3.5e-44 PTHR15241 TRANSFORMER-2-RELATEDTRANSFORMER-2-RELATED
seg[19-41]? NA seg seg[126-135]? NA seg seg[145-168]? NA seg seg[187-211]? NA seg segseg
SSF54928[14-173]T 4e-28 SSF54928 RNA-binding domain, RBDRNA-binding domain, RBD

 

chr02_finished_C02HBa0060J03.1.v1.seq_C02HBa0060J03.1

 

90.97

 

144

 

13

 

0

 

213

 

356

 

9241

 

9384

 

2E-45

 

182.0

 

AK224665

 

attcacgctctccttctccttgggaagaagaaaaggtaagatctagatcccagtctaggtcatggtcgaggccaagaggaagatctaggtccagaagtcaaggaagagttgaaccttctaatcctggcaccacactttatgtaactggtttatccacaagggtgacacagagggaccttgaggagcatttctcaaaggagggaaaggtaaaatcagctttcttggttgtagaaccgcgttctcgtatatctcgtggttttgcttttataacaatggatagtcttgaggatgccaatcgctgcattaagcacctaaatcagtctgtccttgaaggccgctacataacagtggagaagtcacgaaggaaacgcccgaggactccaacgcctggtcactatctagggcttaagaacgcaaggggcgatggtttccgtggcgaccgtggtggtgaccgtggtcggtatcgtggccgtgaggactatgggcgccttgaggactatgggtaccaaagatctcctccaaggcgtttgccttatcgagattattctcctaggcgctcgccttacgggggaaggtcaagaagggaacgatccaggtcatattctccttatgaaaggaagtatggtggtgggggtagataggctgaaaactgtttgttaaggatctttatgagtttggttgggctagattttaggtataatacaccccaatgaatgaatgtatgtcaagtactatgtgtgttttgcaatgacattgaaaactaaagcaattgaacgacattgaaaacaaaaaaaaaa

 

21