FC04BE03

FC04BE03

 

3

 

ORF2

 

6011F57BC9BDB2B6

 

62

 

IPR000215

 

SEQUENCE: FC04BE03_3_ORF2CRC64: 6011F57BC9BDB2B6LENGTH: 62 aa
InterPro
IPR000215
Family
Proteinase inhibitor I4, serpin
PS00284[40-50]? NA PS00284 SERPINSERPIN

 

chr02_finished_C02SLe0042D07.1.v1.seq_C02SLe0042D07.1

 

89.19

 

74

 

8

 

0

 

176

 

249

 

106181

 

106254

 

1E-15

 

83.8

 

AK224643

 

ctctctaaattctatggattaatttgtgattgttgaagaagaaatgggttcatgtgtttcagtgcacaaagaccctcaatttcgtcttgtttttgggtccaaaactgctcatcatactccatcacctctacaacaaaaaccaactcatcgatcttcaacgccctttcctgatttcggtagtaaggaggagaccttctttgattcccaggcttggttagattctgattgtgatgatgacttccttagtgtaaatggagattttaccccttctcgtggtagtactcctgtccatcccagcttggctggaaatttaaaaggtaacagagattcccctgcttcttttcggcaatcaccgccacaggaaaaaaagaagagattgtctgaacttttcagtgaaagcttgagaagtgagctcaatgagcaaaacgtcacaagtacaaaaaaggaaactgcagttactgatgatcgagttccaccaagatctacacctgggacaccttatgcgtctgtgtgtaacagcgaaagaactcccaatggagagctaaaatgtgatgtcaaatcatcgaagccagcacaatgttgtcttccaaggttactctcaagtcgtagctttagtgagaggaggaaaagaatgagcccagcacgtactgttggctgacaacccgaccaataagttgtctctcttaaggtatatatatatatgtgtgtgttttatgtgcatgtttaaggtatacaatatgaactttgatggtcaataaaacttaatggccatgagatttcggggcaaatacacagttgtgtagagttctggtatgttcattcttgaatttgtgtttttttatgtaaaaagatatagaaaaacagctttccaattgaaaaaaaaaa

 

17