AK000902

AK000902

 

Homo sapiens cDNA FLJ10040 fis, clone HEMBA1001009.

 

AK000902

 

AK000902.1

 

source 1..1830|/clone="HEMBA1001009"|/clone_lib="HEMBA1"|/db_xref="H-InvDB:HIT000003376"|/db_xref="taxon:9606"|/dev_stage="embryo, 10 weeks"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="whole embryo, mainly head"|CDS 151..1374|/codon_start=1|/protein_id="BAA91416.1"|/translation="MEEAGGPMARAKAQVVSATLTWRQWPPTQEEIKHGFHKVSLVSG|AQMEAPQKEMFEFSRREEVEVNGFATQEEETVNCQGPRDTAGSKNFQSHGPIFSKKYI|PPPKEKRPEGRLKEAVDQSDGSRQAPRTEPPCVGAMARTELLVPLPGPREPSPHPGVG|LTSGSSRSLEEYRVTRTVRTTTVVGGHVDRRMSSSVTVRPVSSGEALPRGRQVSRMVP|PVVVGSPPGSPSRSQAVKVLSNLVPAGHSPPASHLPRPTAGGPRSTGLGSTVGAALRQ|LPETGTAELKDSSALASTGIPASAHLPKNQDAPAACPDRDQGRAPDARACELWQVLGA|PSSTELPLQTSQGQASVPSSPRLETHVPSPGLTHPAKQPVVPTHPGARLTPLVLPPKK|RTGPWTPLLPPSCPW"

 

HEMBA1001009

 

HEMBA1

 

pME18SFL3

 

embryo, 10 weeks

 

whole embryo, mainly head

 

HIT000003376

 

BAA91416.1

 

agctgagagcccaatcgcatcaggggagcacggcccagcagcaggagctccaggctggctggacacctgggtccccacgcagactgtgagtagagggagctggaccacagtgggacaaggacacctccagacaggttgccagggccccacatggaggaggcaggtgggcccatggcccgggccaaggcccaagtggtaagtgccacattgacatggcggcagtggccccccacccaggaagagatcaaacatggttttcacaaggtgtccctggtgtcaggggcccagatggaagccccgcagaaggagatgtttgagttcagccgtcgagaggaagtggaagtcaatggctttgcaacacaggaagaagagactgtgaattgccagggccctcgggatacagctggctccaagaacttccagagccatggacccatcttttccaagaagtacataccacctcccaaggagaaaaggcctgaggggaggctgaaggaggctgtggaccagagtgatggcagccgccaagctcccaggactgagcccccatgtgtgggagctatggccaggactgagcttttggttcccctgcctgggccccgagagccaagtccccacccaggtgtaggtctcaccagtggtagctcccggagcctcgaggaataccgagtgacacgcactgtgcggaccaccacagtggtgggaggtcatgtggaccggcggatgagcagctctgtgactgtgaggccagtgtcctcaggcgaggccctgccacggggccgtcaggtctcccgcatggtgccgccagtggtggtgggctccccaccaggctcgcccagccgcagccaggccgtgaaagtgctaagtaacctcgtgcctgctgggcacagcccccctgccagtcacctgcccaggcccacggctggcgggccaaggagcacaggtctgggcagcacagtgggggcagccttgaggcagctgcctgagaccgggacagcagagcttaaagacagctctgccctggcctctacaggcatcccagccagtgctcacctgcctaagaatcaggatgcccctgcagcctgtccggacagagaccagggcagagccccggatgccagggcctgtgagctctggcaggtgctgggagcccccagttccactgagctccctctccagacttctcagggtcaagcatcagtcccctcctctcccagactcgagacccatgtcccctctcctggcctaactcaccctgcaaagcagcctgtggtgcccactcaccccggggcccggctcactccccttgttctgccccctaaaaaaaggacgggcccgtggacccccctgctgccaccgtcctgcccatggtgaggagcgagcatgtgacagtccctggacaacctcctgctccatccactacaagaaggaaggatgtccccagcccaggaggtctttctgctccatcgtccccaaggaataagtttgttcagaactctgaaaatgtccctgtcctcccctttacccagagggaggtcgtgaagggccccggtgctgtgggccgagagccgcctgccgcgccagacgtggagcatcagtgaatcgggccacatctgcagccagatgttcgaaggccagatcctggacgtgaagggaggccggggctacgaccgggaccacgtggtgctatgggagccggatgaggacagggcatcccagatctggactatccacgtgctttgaaacttttcccctcaccctccagccctggaggcttttgctgggatgaatgtttttatagggtttttgttgtaacataagctattttct

 

MEEAGGPMARAKAQVVSATLTWRQWPPTQEEIKHGFHKVSLVSGAQMEAPQKEMFEFSRREEVEVNGFATQEEETVNCQGPRDTAGSKNFQSHGPIFSKKYIPPPKEKRPEGRLKEAVDQSDGSRQAPRTEPPCVGAMARTELLVPLPGPREPSPHPGVGLTSGSSRSLEEYRVTRTVRTTTVVGGHVDRRMSSSVTVRPVSSGEALPRGRQVSRMVPPVVVGSPPGSPSRSQAVKVLSNLVPAGHSPPASHLPRPTAGGPRSTGLGSTVGAALRQLPETGTAELKDSSALASTGIPASAHLPKNQDAPAACPDRDQGRAPDARACELWQVLGAPSSTELPLQTSQGQASVPSSPRLETHVPSPGLTHPAKQPVVPTHPGARLTPLVLPPKKRTGPWTPLLPPSCPW

 

39