KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Singlet61

FA05AA04

534

TC171758 similar to GB|AAP37784.1|30725524|BT008425 At4g24690 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (36%)

1851

Show
Singlet61

Singlet61

 

FA05AA04

 

534

 

TC171758 similar to GB|AAP37784.1|30725524|BT008425 At4g24690 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (36%)

 

1851

 

950

 

0

 

479

 

100

 

534

 

AK099686|Os02g0593700 Ubiquitin-associated domain containing protein.

 

845

 

182

 

2.00E-46

 

159

 

55

 

534

 

ref|NP_194200.1| zinc ion binding [Arabidopsis thaliana]

 

704

 

197

 

3.00E-49

 

169

 

56

 

534

 

SGN-U318606

 

1924

 

950

 

0

 

479

 

100

 

534

 

Q5RC94|NBR1_PONPY Next to BRCA1 gene 1 protein (Neighbor of BRCA1 gene 1 protein) - Pongo pygmaeus (Orangutan)

 

894

 

73

 

5.00E-13

 

170

 

31

 

534

 

AT4G24690.1 | Symbol: None | ubiquitin-associated (UBA)/TS-N domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein, contains Pfam profiles PF00627: Ubiquitin-associated (UBA)/TS-N domain, PF00569: Zinc finger ZZ type domain, PF00564: PB1 domain | chr4:12741043-12744543 FORWARD | Aliases: F22K18.110, F22K18_110

 

704

 

197

 

4.00E-51

 

169

 

56

 

CTGGACCTAGGTTCAAATCTAAAGTAAAGGAGGACTATGATCTCTGCAGCATATGCTTTGCACAAATGGGAATTGATGCTGATTACGTCAGAATGGATCGTCCTGTTTCTTACCATCATCCCATAGCTTTCAAGGCTTTACATGAACCTCATGACATCTTTCGAGGCTGCGGTGTAAAATCGCCTAAGCTGGACAGCCGCTTCAAACATGATGTCAATGTACTTGATGGTACTATGATGGCTCCATCGACTCCATTTACCAAGGTCTGGAGGATGAGGAACAATGGTAATATTTTCTGGCCACAAGGAACACAACTTGTTTGGATTGGGGGAGATCGATTAGGTGATGCTGTTTCTGTTGAATTACAGATTCCTTCGTTTGGCTTGGCTGTAGACCATGAATTTGATGTGGCAGTTGATTTTAGAGCTCCTAACCTTCCTGGCAGGTACATCTCCTTCTGGAGGATGGCCTTGCCTTCA

 

479

 

61

 

Singlet62

FA05AB05

302

TC189572 similar to UP|Q94JQ8_ARATH (Q94JQ8) AT3g57880/T10K17_90, partial (18%)

630

Show
Singlet62

Singlet62

 

FA05AB05

 

302

 

TC189572 similar to UP|Q94JQ8_ARATH (Q94JQ8) AT3g57880/T10K17_90, partial (18%)

 

630

 

509

 

1.00E-144

 

257

 

100

 

302

 

AK102476|Os05g0370600 C2 domain containing protein.

 

774

 

61

 

2.00E-10

 

68

 

45

 

302

 

ref|NP_173675.1| unknown protein [Arabidopsis thaliana]

 

1029

 

66

 

3.00E-13

 

68

 

47

 

302

 

SGN-U320760

 

1858

 

500

 

1.00E-141

 

260

 

99

 

302

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

302

 

AT1G22610.1 | Symbol: None | C2 domain-containing protein, contains INTERPRO:IPR000008 C2 domain | chr1:7994280-7997574 FORWARD | Aliases: F12K8.4, F12K8_4

 

1029

 

66

 

5.00E-12

 

68

 

47

 

CCCCCTTTGTCTGCATCTGAACCTTTTGAGGAGCATTTGATAATACATGTCGTGGATAGAGTTGGACCAGGGCAAAGATGAATTGATTGGCAGGGCTATGATATCATTTAAGAATATTCCAACCAGAGTTGATAACTCTAAGTTACCAGATGCTATATGGTTCAATCTTCTCAAGCCTTCTCATGCGGCAGATGATGACGAGAAGAAGAAAGAAGTGAAGTTCTCTAGCAAGATTCACCTTAGAATTTGGATAGATGCTGGTTACCATGTTCTTGA

 

276

 

62

 

Singlet63

FA05AC05

541

TC181343 weakly similar to GB|AAT41865.1|48310676|BT014882 At1g80110 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (53%)

1234

Show
Singlet63

Singlet63

 

FA05AC05

 

541

 

TC181343 weakly similar to GB|AAT41865.1|48310676|BT014882 At1g80110 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (53%)

 

1234

 

946

 

0

 

477

 

100

 

541

 

AK106918|Os02g0812500 Cyclin-like F-box domain containing protein.

 

332

 

150

 

4.00E-37

 

152

 

49

 

541

 

gb|ABB77431.1| non-S-locus F-box-like protein 2011 [Petunia inflata]

 

143

 

179

 

4.00E-44

 

122

 

72

 

541

 

SGN-U336653

 

1116

 

930

 

0

 

477

 

99

 

541

 

Q9ZVR5|PP2B2_ARATH Putative F-box protein PP2-B2 (Protein PHLOEM PROTEIN 2-LIKE B2) - Arabidopsis thaliana (Mouse-ear cress)

 

305

 

156

 

5.00E-38

 

147

 

51

 

541

 

AT2G02250.1 | Symbol: ATPP2-B2 | F-box family protein / SKP1 interacting partner 3-related, contains similarity to SKP1 interacting partner 3 GI:10716951 from (Arabidopsis thaliana) | chr2:594654-595809 REVERSE | Aliases: T16F16.4, T16F16_4, ATPP2-B2

 

305

 

156

 

8.00E-39

 

147

 

51

 

CCATTTGACGTAGCTCCGGTGGTGGCGGTGGTGATATCTGCCACCTGCCGGAAGGTTGCATAGCCAACGTACTATCATTGACGAGTCCGAGAGATGCGAGTAGGTTATCGGTGGTCGGTACGGTTTTCCGGTCGGCTGGTGAATCTGACGCCGTTTGGGACCGGTTTTTGCCGTCGGATTACCGTGATATTATTTCCCGGTCTAGTGATGGACCGGAATCGTTCAATGTCGGTTCTAAGAAAGAGCTTTATCTCTATCTATGTGATCATCCTTTCTTCATCGACGGTGGGACTAAGAGCTTCTCATTGGAGAAGCAGAGTGGAAAGAAATGCTACATGTTAGCTGCGAGGTCGCTAGCAATTATTTGGGCTGACACACCACGGTATTGGAGATGGATCCCCCTTCCTGAGTCCAGGTTCCCAGAGGTTGCTGAGCTTCTTGACGTGTGCTGGTTTGATATTTCTGGCAAGATAAACACCTCTA

 

483

 

63

 

Singlet64

FA05AD10

108

No hits found

0

Show
Singlet64

Singlet64

 

FA05AD10

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

ATATCAACCTTATCGATACCGTCGAC

 

26

 

64

 

Singlet65

FA05AE11

438

TC183838 similar to GB|AAF23822.1|6685163|AF219223 homocysteine S-methyltransferase AtHMT-2 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (65%)

787

Show
Singlet65

Singlet65

 

FA05AE11

 

438

 

TC183838 similar to GB|AAF23822.1|6685163|AF219223 homocysteine S-methyltransferase AtHMT-2 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (65%)

 

787

 

406

 

1.00E-113

 

424

 

83

 

438

 

AK103743|Os10g0422200 Homocysteine S-methyltransferase 3 (EC 2.1.1.10) (S- methylmethionine:homocysteine methyltransferase 3) (SMM:Hcy S- methyltransferase 3) (ZmHMT-3).

 

335

 

100

 

3.00E-22

 

142

 

38

 

438

 

ref|NP_566715.1| HMT3: homocysteine S-methyltransferase [Arabidopsis thaliana]

 

347

 

116

 

3.00E-25

 

142

 

42

 

438

 

SGN-U322411

 

1456

 

414

 

1.00E-115

 

428

 

83

 

438

 

Q8LAX0|HMT3_ARATH Homocysteine S-methyltransferase 3 (EC 2.1.1.10) (S-methylmethionine:homocysteine methyltransferase 3) (SMM:Hcy S-methyltransferase 3) (AtHMT-3) - Arabidopsis thaliana (Mouse-ear cress)

 

347

 

116

 

2.00E-26

 

142

 

42

 

438

 

AT3G22740.1 | Symbol: None | homocysteine S-methyltransferase 3 (HMT-3), identical to homocysteine S-methyltransferase HMT-3 (Arabidopsis thaliana) GI:9966515: similar to homocysteine S-methyltransferase AtHMT-2 (GI:6685163) (Arabidopsis thaliana): similar to selenocysteine methyltransferase GB:P56707 from (Astragalus bisulcatus) | chr3:8032966-8035816 REVERSE | Aliases: MWI23.11

 

347

 

116

 

4.00E-27

 

142

 

42

 

GANAGNANGNGAAGNGNGAAANATATATAATGAGAGAGNTNNNAAAGGGNNTTGGGATGATTTTATTGATGGAGNNGGTTTGAAANGNAATNNGGTNTTGGTTGGAGNGTNTGTGGGAAGTTANGGAGNTTATTTGGNTGATGGTTNTGAATATAGTGGAATTTATGGTGATGNGATTANTGTGAAAGNTNTAAAAGATTTTNATNGAAGGAGAGTANAGGTTNTTGGGGATTNAGGTGGTGATTTGATTGGATTTGAGAAAANTNNAAANAAAATNGAAGNTNAGGGTTATGNTGAGATTNTTGAGGAAGAGGNTATNAANGTTNNTGTGTGGTTTTNNTTNAGTTNTAAAGAAGGTATNAATGTAGNNAGTGGNGATTNNATTGNAGAATGTGNTTNAATTGTTGATTNGTGTAAGNAAGTNGTTGGAATTGGAAT

 

438

 

65

 

Singlet66

FA05AF06

235

BP876523

194

Show
Singlet66

Singlet66

 

FA05AF06

 

235

 

BP876523

 

194

 

377

 

1.00E-104

 

194

 

99

 

235

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

235

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

235

 

SGN-U345946

 

1283

 

387

 

1.00E-107

 

211

 

98

 

235

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

235

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TGGACCCCGGGCGCGGAATTGGACGCCCCTTTTTCCGAAGCAAAAATAATGTCCATTGTGGTGGAATGACTTCAAGTCCAAACATCCCTAAGCTTCAAGGATGAAGGGAGGTTTGAACGTGTCACAGATCTCTCTCATCCTGATCGGATTCGTGTGTGCTTCTGTTCTTCTTTTGGCATATGTGAAGAGCCTACTTCTTTCTTCTTCAGTACTACCTCAGAATCATGTCTTGCAG

 

235

 

66

 

Singlet67

FA05AF09

534

BP876526

512

Show
Singlet67

Singlet67

 

FA05AF09

 

534

 

BP876526

 

512

 

1015

 

0

 

512

 

100

 

534

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

534

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

534

 

SGN-U343787

 

1094

 

1047

 

0

 

531

 

100

 

534

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

534

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

NACAAATNATGATCAACAAAATCTCACCCCGTATCCTGTGCTGGGAATACTGAAAGGCATGGTTGCTTGCTCTCCTAGTATCCAAATCAATCAGGCCATTCCAAGGCCTCAAGTTTGTCCTCCTCACTTCAGTCACCAAATTGATTCGGTGCAGCAAAATTGTTTAGGTGCAATCAAACAAAGCCCTTTCACCCTGTATAATCAGAAAGCAAATTTTGAGGAGCCTTTTCCAGGTGGATATAAATCTTTCACAATCAGCCCATATGGACCTGTACCAACATTAATGCATCATTACTCCAGCCAGAATGGGGGCTCGAGCTCTCTTGATCTGAACAGCTCAAGCTGTGCCATCAACTTTCCTTACTCACGTCTAGATTCCGGAAGGAACTTCCGATCATCGTGGTCTCAGTTCTCTACAGAAAGCACCCCATGGTTTTCAGATGCAAAACAAAAGAAACTACTAATGGATTTTCATGAATTATATTCTTCATCTGACAGGAAACATCATTACTGCAGCAGCATTACTGGGGATAG

 

534

 

67

 

Singlet68

FA05BB02

531

TC185921 weakly similar to UP|GLR37_ARATH (Q9SDQ4) Glutamate receptor 3.7 precursor (Ligand-gated ion channel 3.7) (Ionotropic glutamate receptor GLR5), partial (18%)

612

Show
Singlet68

Singlet68

 

FA05BB02

 

531

 

TC185921 weakly similar to UP|GLR37_ARATH (Q9SDQ4) Glutamate receptor 3.7 precursor (Ligand-gated ion channel 3.7) (Ionotropic glutamate receptor GLR5), partial (18%)

 

612

 

950

 

0

 

479

 

100

 

531

 

AK099753|Os04g0585200 Glutamate receptor 3.3 precursor (Ligand-gated ion channel 3.3).

 

348

 

185

 

1.00E-47

 

160

 

61

 

531

 

sp|Q7XP59|GLR31_ORYSA Glutamate receptor 3.1 precursor (Ligand-gated ion channel 3.1)

 

938

 

185

 

8.00E-46

 

160

 

61

 

531

 

SGN-U330325

 

1103

 

955

 

0

 

482

 

100

 

531

 

Q7XP59|GLR31_ORYSA Glutamate receptor 3.1 precursor (Ligand-gated ion channel 3.1) - Oryza sativa (Rice)

 

938

 

185

 

7.00E-47

 

160

 

61

 

531

 

AT1G42540.1 | Symbol: None | glutamate receptor family protein (GLR3.3), plant glutamate receptor family, PMID:11379626 | chr1:15975929-15979143 FORWARD | Aliases: T8D8.1, T8D8_1

 

933

 

180

 

5.00E-46

 

160

 

60

 

GCACTCTTGGTCGAATGGTAATGGTGGTTTGGCTATTCTTACTCCTGGTGATCACATCAAGCTATACAGCAAGTTTGACATCCATCCTTACAGTACAGCAACTTTTATCACCGATCACAGGAATTGATAGTTTGATTGCAAGCAACTCATTGATTGGATATCAAGTTGGGTCATTTGCCTATAGCTATTTGAAAGACATTCTTAACATAGCTCCATCAAGATTAAAATCTCTGCGATCTCCAGAAGAATTTGAAGCTGCACTGCGGCAAGGTTTAGGAAATGGAGGAGTGATGGCAATTGTTGATGAACTTCCGTACATGGAGTTGTTCCTTCAAAACCGTACTGATTTTGGGATCATTGGTCGACCATTTACTAAGAGCGGATGGGGTTTTGCTTTCAAAAAGGATTCTCCTCTGGCTAACGATATGTCAACAGCAATCCTGAAACTGGCGGAGAGTGGGAAACTTCAAGAGATACACGAA

 

482

 

68

 

Singlet69

FA05BC04

542

BP876574

500

Show
Singlet69

Singlet69

 

FA05BC04

 

542

 

BP876574

 

500

 

991

 

0

 

500

 

100

 

542

 

AY062184|Os02g0725700 CCAAT-binding transcription factor subunit A (CBF-A) (NF-Y protein chain B) (NF-YB) (CAAT-box DNA binding protein subunit B) (Fragment).

 

254

 

108

 

3.00E-24

 

98

 

54

 

542

 

emb|CAI05932.1| leafy cotyledon 1-like protein [Helianthus annuus]

 

214

 

134

 

3.00E-30

 

152

 

51

 

542

 

SGN-U345867

 

1235

 

1009

 

0

 

509

 

100

 

542

 

Q84W66|NFYB6_ARATH Nuclear transcription factor Y subunit B-6 (AtNF-YB-6) (Protein LEAFY COTYLEDON 1-LIKE) - Arabidopsis thaliana (Mouse-ear cress)

 

234

 

115

 

9.00E-26

 

147

 

45

 

542

 

AT5G47670.1 | Symbol: None | CCAAT-box binding transcription factor family protein / leafy cotyledon 1-related (L1L), supporting cDNA gi:27372446:gb:AY138461.1:: contains Pfam PF00808 : Histone-like transcription factor (CBF/NF-Y) and archaeal histone: contains similarity to CCAAT-binding transcription factor subunit A (CBF-A) (NF-Y protein chain B) (NF-YB) (CAAT-box DNA binding protein subunit B) (Swiss-Prot:P25209) (Zea mays) | chr5:19332287-19333616 FORWARD | Aliases: MNJ7.26, MNJ7_26

 

234

 

115

 

2.00E-26

 

147

 

45

 

GAAATATTAGAGAGAGAAAGAGATGGATGGTGGTTCAGGAAATGGAGGATTTCATAGCTATCGCAGATCTCCACAACCAACCCCTGCAGATCCCCCTTCCTCTGATGTGGAGATGAGCCTGGAACTGCCTGCACATCTCAACCAGGAAGTTGATGAAATCATCAGTCAGGAGCAAGACGAAGTCATACCAAACGTGGCCAGAATCATGCATAGCACCCATCCTTCCCATGTCAAGATATCCGATGACGCCAAACGGACCATGTACCATTGTATGTCTGAGTTCATATGCTTTGTAACATACGAAGCCAACACGCATTGCCAGCGTGAGCAGCGGAACACAATCACTGTTGAAGACGTGGATTGGGTCATTAACAAGTTTGGGTTTGATGACTACATTGAACCCTTGCCTTACTACTTTCCTCCAAATAGTGAGGATGATGGTGGCGAGTGTGGATCTCTTACAAGGGAGTCTTTGTTGAAGTGTCCAATGGTTGATACAGCTTCAAGCT

 

509

 

69

 

Singlet70

FA05BC05

540

TC180452 similar to UP|SUT42_ARATH (Q8GYH8) Probable sulfate transporter 4.2, partial (22%)

478

Show
Singlet70

Singlet70

 

FA05BC05

 

540

 

TC180452 similar to UP|SUT42_ARATH (Q8GYH8) Probable sulfate transporter 4.2, partial (22%)

 

478

 

948

 

0

 

478

 

100

 

540

 

AK069796|Os09g0240500 Sulfate transporter 4.1, chloroplast precursor (AST82).

 

748

 

229

 

1.00E-60

 

160

 

71

 

540

 

emb|CAC94921.1| sulfate transporter [Brassica napus]

 

691

 

234

 

1.00E-60

 

160

 

73

 

540

 

SGN-U329797

 

1036

 

959

 

0

 

484

 

100

 

540

 

Q8GYH8|SUT42_ARATH Probable sulfate transporter 4.2 - Arabidopsis thaliana (Mouse-ear cress)

 

677

 

231

 

9.00E-61

 

160

 

71

 

540

 

AT5G13550.1 | Symbol: None | sulfate transporter family protein, similar to sulfate transporter (Arabidopsis thaliana) GI:3777483: contains Pfam profiles PF00916: Sulfate transporter family, PF01740: STAS domain | chr5:4355279-4359555 REVERSE | Aliases: None

 

685

 

231

 

1.00E-61

 

160

 

73

 

CAGTTTGTGATATCTGCTGTAATTGGACTGGTGGATTACGACGAGGCTAAATTTTTGTGGCGTGTTGACAAGAAAGATTTTCTGTTATGGACTATCACTTGCATGACAACCTTGCTTCTAGGCATAGAGATTGGTGTCCTTGTTGGGGTTGGCGTGTCACTTGCTTTTGTTATTCATGAATCGGCAAATCCGCATATTGCTGTCTTGGGGCGTCTTCCTGGAACTACTATTTACAGAAATACTCAGCAATACCCCGAAGCATATACATACAACGGTATTGTGATTGTTCGAATTGATGCACCTATATACTTTGCGAACACAAGTTACATAAAAGACAGGTTACGGGATTATGAAATTGAAAAAGAGGAATCTAAAGGTCGGGGACCAGAAGTTTCAAGAATTCATTTTGTGATCCTTGAGATGGCCCCTGTTACGTATATAGATTCCAGTGCTGTTCAAGCTCTGAAAGAGCTCCATCAGGAATATAA

 

488

 

70

 

Singlet71

FA05BD03

108

No hits found

0

Show
Singlet71

Singlet71

 

FA05BD03

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

108

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

CCTTGTCTATTAACTGATTCTAAGGCTGCTAGCAGTTTCACCATGCCTAATCCTGCCCTTTGGCAGGCATCTTTTGA

 

77

 

71

 

Singlet72

FA05BD07

449

BP876585

438

Show
Singlet72

Singlet72

 

FA05BD07

 

449

 

BP876585

 

438

 

868

 

0

 

438

 

100

 

449

 

AK072070|Os02g0739100 Actin-binding FH2 domain containing protein.

 

484

 

177

 

3.00E-45

 

149

 

61

 

449

 

ref|NP_177171.1| ATFH8: actin binding / actin filament binding / profilin binding [Arabidopsis thaliana]

 

760

 

177

 

1.00E-43

 

148

 

64

 

449

 

SGN-U342596

 

1053

 

890

 

0

 

449

 

100

 

449

 

Q9NSV4|DIAP3_HUMAN Protein diaphanous homolog 3 (Diaphanous-related formin-3) (DRF3) - Homo sapiens (Human)

 

1110

 

60

 

4.00E-09

 

61

 

49

 

449

 

AT1G70140.1 | Symbol: ATFH8 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. | chr1:26416351-26418893 REVERSE | Aliases: F20P5.14, F20P5_14, ATFH8, FORMIN 8

 

760

 

177

 

2.00E-45

 

148

 

64

 

TTAGCAAGGAGCTTAAAGCTCAAAGATTGTTCTTGAAACTTCTAGAAGCTATTTTGAAAGCGGGGAATAGAATGAATGCCGGAACTTCAAGAGGAAACGCACAAGCGTTTAAACTTACTGCTCTCAGAAAACTGTCTGATGTGAAAAGTATGGATGGTAAGACCACATTACTTTACTTTGTTGTGCAAGAAGTAGTCAGAGCAGAAGGAAAACGTTGCGTTCTAAATCGTAATCAAAGTTTAAGGCGTAGCAATAGCCAGACTACTGCGAGCAGCGCCATTCCGACATCAAAGAACACTACAGAAAATGATGAGACCGACAAGGAGTATATGATGCTTGGCTTACCAATAGTGGGTGGATTAAGTTCTGCATTTAGTAATGTAAAGAAAGCAGCTGCAATAGACTATGACTTGCTGTCCAAGACGTGCTCGATGCTAACAGCTCAGATA

 

449

 

72

 

Singlet73

FA05BH01

538

BP876618

477

Show
Singlet73

Singlet73

 

FA05BH01

 

538

 

BP876618

 

477

 

946

 

0

 

477

 

100

 

538

 

AK102030|Os11g0246900 Ankyrin repeat containing protein.

 

576

 

241

 

2.00E-64

 

160

 

75

 

538

 

emb|CAI84657.1| hypothetical protein [Nicotiana tabacum]

 

621

 

297

 

2.00E-79

 

159

 

93

 

538

 

SGN-U337569

 

1136

 

954

 

0

 

481

 

100

 

538

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

538

 

AT3G59910.1 | Symbol: None | expressed protein | chr3:22141460-22144533 REVERSE | Aliases: F24G16.180

 

611

 

283

 

6.00E-77

 

159

 

86

 

TTTATGGCACGAAGGTTGCATGAACGACTACGAGAATGCAGTGGAGATGAAGTCTTGAAGGCTGAAGCTGGTGCTAAGGTTCAGAAATTCACTGAATGGGCTCTTAAATGTATAGGTTTCCATTCCCGCTGCCAAGGAAAGAGAGATACGGTTGGGAAGAACTCTGCTGTTGAAATACAATTGCAGTTATCAGCTTTCAAAACTTTCCTGGATCTTGCTGGGAATCACCTTACTGGGAAGGACTTTACAGAAGCATTTGATGCAGCTTGCTTTCCGCTTACACTATTCCCTAGTTCATTTGATACTTGCTGGGCATCAGGAATTTCAGCTACTGCAATCCAAGGATTGCTCGGCATGTTGGTGGATGGGGGTGCAGACAATGTCAATCAGTGCTTTCTTGAAGCTTCACGTTTTGGGAGCACAGAGCTGGTCCGCATTCTTTTGCAGATTGCTCAAAGGAACAGCTTGGATGTTGATGTTG

 

481

 

73

 

Singlet74

FA05BH04

536

TC185964 similar to UP|Q6NPS8_ARATH (Q6NPS8) At3g02280, partial (73%)

1814

Show
Singlet74

Singlet74

 

FA05BH04

 

536

 

TC185964 similar to UP|Q6NPS8_ARATH (Q6NPS8) At3g02280, partial (73%)

 

1814

 

938

 

0

 

481

 

99

 

536

 

AK066744|Os01g0733600 Flavodoxin/nitric oxide synthase domain containing protein.

 

626

 

209

 

7.00E-55

 

159

 

64

 

536

 

gb|ABD96847.1| hypothetical protein [Cleome spinosa]

 

630

 

234

 

2.00E-60

 

162

 

69

 

536

 

SGN-U322968

 

2490

 

952

 

0

 

480

 

100

 

536

 

P37039|NCPR_CAVPO NADPH--cytochrome P450 reductase (EC 1.6.2.4) (CPR) (P450R) - Cavia porcellus (Guinea pig)

 

678

 

97

 

4.00E-20

 

161

 

35

 

536

 

AT3G02280.1 | Symbol: None | flavodoxin family protein, low similarity to SP:Q05001 NADPH-cytochrome P450 reductase (EC 1.6.2.4) {Catharanthus roseus}, similar to NADPH-dependent FMN and FAD containing oxidoreductase (Homo sapiens) GI:6694369: contains Pfam profiles PF00258: flavodoxin, PF00667: FAD binding domain, PF00175: Oxidoreductase NAD-binding domain | chr3:453430-457848 FORWARD | Aliases: F14P3.7, F14P3_7

 

623

 

222

 

1.00E-58

 

159

 

64

 

CCATTGGATGATTTTCCATCCGTTCAGATGCCTTTTGAATGGTTGGTTCAGTTGGTACCTCCACTAAAAACTAGGGCTTTTTCCATCTCTTCTTCTCACTCAGCTCATCCAAACCAAGTGCATTTAACTGTTAGTGTGGTATCGTGGACAACACCTTATAAGAGGAAGCGCACGGGTCTTTGCTCGTCATGGTTAGCTGAACTTGATCCTCAGAAAAGTGTCCTCATACCGGCATGGTTTCAAAAAGGTTCTCTTCCTTCCCCTCCACCTTCACTTCCTCTTATTCTAATTGGACCTGGCACAGGGTGTGCACCTTTTCGTGGATTTGTGGAGGAAAGAGCCCTTCAGAGTCAATCCGGTCCTACTGCTCCCATTCTTTTCTTCTTTGGTTGTAGAAATGAAGAAAATGACTTCTTATACCGAGATTTTTGGTTGTTGCATTCACAAAAGGGTGGAGTCCTTTCTGAAGAAAAAGGTGGCGG

 

482

 

74

 

Singlet75

FA05BH06

536

BP876623

469

Show
Singlet75

Singlet75

 

FA05BH06

 

536

 

BP876623

 

469

 

529

 

1.00E-150

 

267

 

100

 

536

 

AK066634|Os10g0561200 Conserved hypothetical protein.

 

521

 

114

 

3.00E-26

 

82

 

62

 

536

 

ref|NP_193473.1| unknown protein [Arabidopsis thaliana]

 

507

 

133

 

5.00E-30

 

84

 

73

 

536

 

SGN-U346069

 

1182

 

529

 

1.00E-150

 

267

 

100

 

536

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

536

 

AT4G17430.1 | Symbol: None | expressed protein, weak similarity to CigA protein (Mucor circinelloides) GI:9717020 | chr4:9724852-9726840 REVERSE | Aliases: DL4750C, FCAALL.1

 

507

 

133

 

7.00E-32

 

84

 

73

 

CCTTTTATGAGCGTCACTGTCCTCTATCTCTGATCCAAGAATTCATAGAGTTCAATTGAATCCATGGAAACTGAAACCTTCATTAGACCCAACAACAAATCAAAGAAGAAACAAAGATCTCCACTTTTAACTTTCCTTTTTCTCTTCACTTTGATTCTCCTTTTCTTCTACTTCAAAAACTTCATTTCCCCTTCTCTTCTTCCCCTTTCAAAAAAATCAATACCCATTATACCCCGTCCCCAACAATGCAACCCCGAAAATCGCCTGCAGGAGAAGTTCATGTGGTATGCGCCTCACAGTGGGTTCAGCAACCAATTGGCTGAGTTCAAGAATGCGATTTTGATGGCTAAGATTCTAAATCGGACCCTAATTGTACCACCCGTGTTGGATCACCATGCTGTTGCGCTTGGTAGTTGTCCTAAATTTAGGGTTTTGGAACCTAATGAATTGAGATACTTGGTTTGGAATCATAGTATTCAGCTC

 

483

 

75