KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Contig23022

sgn|E367436/FA28AB05/FA51BE08/sgn|E316918

1040

TC178504 similar to UP|Q29PY0_ARATH (Q29PY0) At1g01225, partial (76%)

699

Show
Contig23022

Contig23022

 

sgn|E367436/FA28AB05/FA51BE08/sgn|E316918

 

1040

 

TC178504 similar to UP|Q29PY0_ARATH (Q29PY0) At1g01225, partial (76%)

 

699

 

1265

 

0

 

654

 

99

 

1040

 

AK105121|Os09g0526800 NC domain containing protein.

 

268

 

330

 

8.00E-91

 

219

 

71

 

1040

 

ref|NP_563621.1| unknown protein [Arabidopsis thaliana]

 

260

 

349

 

2.00E-94

 

216

 

77

 

1040

 

SGN-U328157

 

845

 

1279

 

0

 

653

 

99

 

1040

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

1040

 

AT1G01225.1 | Symbol: None | NC domain-containing protein-related, contains weak hit to Pfam profile PF04970: NC domain | chr1:95987-97407 FORWARD | Aliases: None

 

260

 

349

 

2.00E-96

 

216

 

77

 

AAATTCTTACAAGGAACGTAAAAGCTGAAGGGTGCTTTGTGTATAGACTCCTTCCTTTCCGAGTTTGGCAGTATTTTATGTGTCTACTGTCTACTAGTATAATTTTTGAAAATTATTCTTGCCTTGTCAAAGTGGCAAAGAATTGCATCTGCATATACAGTTTCACTTGAACCTACTTGACTTTTGACAATTCTAGTAAAACGTAAAAGGGTAAAAAAAATGCCCTACTACTCTGGAAATAGCTCTTTCATGCTGCTCAGTCATTTCAATTGCTGACCCTGGCAGTCAAAAGGAGATGAATTGAGACAGAAAAAGCAAATATGTGGGTTGTTAAAGATTGCGAATTTATTCCAAGTTCATTTGCATTCTGGGGAAGAGTNAAAGGATGAGGGAGAGAAGATGGGTTTGTTGACAAACAGAGTGGACAGAAGTGAGATCAAACCAGGAGACCATATCTATACTTACAGAGCTGTTTTTGCTTACTCCCACCATGGTATTTTCGTTGGCGGAAGCAAAGTGGTTCATTTTACACGGGTTGAGGGCTCTTCTGATGCTGCTAATGAAATATCAGGCATTTCTTCATCCTGTCCAATCTTTCCAGACTGTGGATTTAGGCTTCCTAACAGCGGTGTTGTACTTTCTTGTCTGAATTGCTTTCTCCGCAATGGTTCACTCTACAGTTTTGAATATGGAGTAAGCCCCTCTGTTTTCTTATCCAAAGTGCGAGGTGGAACTTGCACTACTGCTGTGTCAGACCCTCCAGAGATGGTTATCCATCGAGCAATGCATCTTCTCCAGAATGGATTTGGCAACTATGATGTGTTCCAAAACAACTGTGAGGACTTTGCGTTGTATTGCAAAACAGGTCTTCTGACACTAGATAGATTGGGAGTTGGAAGAAGTGGACAAGCTTCTTCTGGTGTTGGTGCTCCTTTAGCTGCGCTTCTTTCTTTCCCCCTGAAGTTTCTAATTCCTAGTCCCGTTGGCATGGCCACTGTTACTGCAGGAATGTACTGCATGAGCAGATATGCTACTGATAT

 

1040

 

45706

 

Contig23023

sgn|E367542/LEFL1034AF12/LEFL1021CE02

777

TC187127

426

Show
Contig23023

Contig23023

 

sgn|E367542/LEFL1034AF12/LEFL1021CE02

 

777

 

TC187127

 

426

 

543

 

1.00E-154

 

371

 

94

 

777

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

777

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

777

 

SGN-U330372

 

414

 

613

 

1.00E-175

 

366

 

95

 

777

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

777

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

CTCCAATGTATAGAAAACCCAAATTCAGCCCGTACGACCCCCTCCAGCGAGAACGTGATTTCTCAAAAAAAGCAGCGATAGGCACAAATCGTTCTCCCTCCCCTTGTCGTTTTCTTTGAGCTCTCTTCCCACAATACTATTGTAACAGGAGCAAATCGTCTTTTGGCTCGAGATCGATCCATGTATTCCCCCTAGGACACCAAATCGATCGAAGACGTTCGTCCCTCTTTCCTCTTCAGGGATAGAGCTGGAACCTCAGAAAAAGGTGTTGGTCTTTTTCGGTGAAAGAATTCAAATTTGTTGAAGATGAGTTTTGACCCGAATTCGATCCGTTTGTTTTAAAAAAGAACGAAAACCCTAGTCATTATATATATATAATTGCCTTGGTTCATTTGAGGGGGGGAGGGGATTTTTGTAGAAAGAAATACAGAGGAGAAATTATTTTTAGGGAAAAGAAAAAAAAGAGCAATTTTTTTGAGTTGCTCTTGGTTTGGAAATTCTTGACAGAGCTTCTAACAAGTTTTTAAGAATATGCGCAAGTATAACTCCGAACAGAAAATTCTTGGGTTTGTTGTCGATTTCTTTGATTACTGTTCGTGTGAGAAGTTTTTTTTTCGTGGTAACGTTGGTCATCTTATATTCATCGTCCCAAAGTCGCTGTCCGGAAAAGGAAATTCCCTTCCCTGTTTGATATTTTTCTCGTCTTTTCTATTTTAACGAGATGTGTTAGTTGGGGTTATAGATTGTTGTCGAATTTGGTGTTTAAAATATGATGTA

 

777

 

45707

 

Contig23024

sgn|E367577/sgn|E327208

595

TC189936 similar to UP|Q8GS71_ARATH (Q8GS71) Kinesin-like protein, partial (16%)

505

Show
Contig23024

Contig23024

 

sgn|E367577/sgn|E327208

 

595

 

TC189936 similar to UP|Q8GS71_ARATH (Q8GS71) Kinesin-like protein, partial (16%)

 

505

 

977

 

0

 

505

 

99

 

595

 

AK100974|Os09g0114500 Kinesin-like protein (Fragment).

 

1035

 

286

 

5.00E-78

 

195

 

78

 

595

 

dbj|BAB11329.1| kinesin-like protein [Arabidopsis thaliana]

 

1032

 

338

 

1.00E-91

 

197

 

88

 

595

 

SGN-U332569

 

595

 

1179

 

0

 

595

 

100

 

595

 

P33174|KIF4A_MOUSE Chromosome-associated kinesin KIF4A (Chromokinesin) - Mus musculus (Mouse)

 

1231

 

83

 

6.00E-16

 

204

 

29

 

595

 

AT5G47820.2 | Symbol: None | kinesin-like protein (FRA1), identical to kinesin-like protein (Arabidopsis thaliana) GI:27260890: contains Pfam profile PF00225: Kinesin motor domain | chr5:19383709-19389978 FORWARD | Aliases: None

 

1035

 

338

 

2.00E-93

 

197

 

88

 

GAAGAAGGAATGAGTATGAGAGACATAAATTGCTAGCTTTAAATCAACGACAAAAGATGGTTCTTCAAAGAAAGACGGAGGAGGCTGCTATGGCAACTAAGAGACTAAAAGAATTGCTAGAAGCGCGTAAATCTTCAGGTCGCGAGAACTCAGTTACTAGCAATGGCCATGTAGCAAATGGACAGAGCAATGAGAAATCGTTGCAACGTTGGCTTGATCATGAGCTTGAAGTGATGGTGAATGTTCATGAAGTTCGTCATGAGTATGAGAAGCAAAGTCAAGTACGAGCCGCACTTGGTGAAGAGCTAGCAGTTTTGAAACAAGTTGATGAATTTGCTTCAAAAGGACTGAGTCCTCCAAGGGGTAAAAATGGCTTCTCTAGGGCATCTTCAATGTCGCCAAATGCTAGAATGGCACGAATTGCTTCTCTAGAGAATATGTTACGCATTTCATCCAATTCTCTAGTTGCAATGGCTTCACAACTTTCAGAAGCAGAAGAACGAGAGCGTGCTTTTAGCAATCGTGGGCGTTGGAACCAACTACGCTCGATGGGGGATGCAAAAAGTTTGCTCCAATATATGTTCAATTCTCTTGC

 

595

 

45708

 

Contig23025

sgn|E367574/sgn|E367516

437

TC183990 weakly similar to RF|XP_720128.1|68471643|XM_715035 D-lactate dehydrogenase {Candida albicans SC5314} (exp=-1: wgp=0: cg=0), partial (24%)

970

Show
Contig23025

Contig23025

 

sgn|E367574/sgn|E367516

 

437

 

TC183990 weakly similar to RF|XP_720128.1|68471643|XM_715035 D-lactate dehydrogenase {Candida albicans SC5314} (exp=-1: wgp=0: cg=0), partial (24%)

 

970

 

837

 

0

 

438

 

99

 

437

 

AK065328|Os07g0187200 Hypothetical protein.

 

108

 

65

 

2.00E-11

 

42

 

64

 

437

 

dbj|BAC79943.1| putative actin interacting protein [Oryza sativa (japonica cultivar-group)]

 

559

 

211

 

9.00E-54

 

145

 

68

 

437

 

SGN-U325850

 

972

 

842

 

0

 

437

 

99

 

437

 

Q8N465|D2HDH_HUMAN D-2-hydroxyglutarate dehydrogenase, mitochondrial precursor (EC 1.1.99.-) - Homo sapiens (Human)

 

521

 

143

 

2.00E-34

 

129

 

52

 

437

 

AT4G36400.2 | Symbol: None | FAD linked oxidase family protein, low similarity to SP:Q12627 from Kluyveromyces lactis and SP:P32891 from Saccharomyces cerevisiae: contains Pfam FAD linked oxidases, C-terminal domain PF02913, Pfam FAD binding domain PF01565 | chr4:17197252-17200924 FORWARD | Aliases: None

 

559

 

202

 

8.00E-53

 

145

 

67

 

CTGAAACATCTAGAAGGTGTCCGCAATCCATTTCCTTCCTCAATGCATAACTTTTATGTTCTTATTGAGACAACTGGAAGCAGTGAATCTTATGATAGAGAGAAACTAGATGCCTTCTTGCTTCACTCAATGGAAAATGACTTGATAAGTGATGGAGTTGTTGCACAAGATATAACTCAGGCATCTTCTTGCTGGCATATTCGTGAGGGTATTCCTGAAGCTTTGATGAAAGCAGGAGGTGTATATAAATACGATTTGTCAATACCAGTTGAAAAGATGTATGATCTTGTTGAGGAAATGGGAGTCCGACTTGGTGCTTCAGCAAAAGTAGTCGCTTATGGTCACCTTGGGGATGGAAACTTACATCTTAATATCTCAACTCCTCAGTATGATGATAATATTTTATCACAGATTGAACCCTTCGTTTATGAATGGAC

 

437

 

45709

 

Contig23026

sgn|E367478/sgn|E367580/LEFL1031CB04

418

TC188445

348

Show
Contig23026

Contig23026

 

sgn|E367478/sgn|E367580/LEFL1031CB04

 

418

 

TC188445

 

348

 

480

 

1.00E-135

 

286

 

96

 

418

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

418

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

418

 

SGN-U332673

 

416

 

541

 

1.00E-153

 

314

 

96

 

418

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

418

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TAGTCTCGAGTTTTTTTTTTTTTGTTGCAATGTAAAATCTCTCTCTTTTTTTCCCTTTTGGCTTCTTTATTTGAAATTCCTTAAGCTGCTGACACCTTAGCTATCTCTTGTTGTGTTTCTCTTTTCTCAAACTCTTTTTGTTTTCATTAATAACTGGATCTTGATTTCTTTTTCTTCACCAAACTAACAATTTTGGGGTGTTTTTGCTCAAAAAAGATTCTTACTTTTTGTTCATTTACTCATTTTTAAAGCTTGGGGTTTTGCATTACCATTTCATCTTTCAATTTTGTTTAATGGGTCTTCAAAAAGTTTGAGTCTTGGGTATTGTATAATTCATGTTTTTGAGTTTTTGAGTTCATTTTTTTAAAAAGGGGTTCTTGTATATTGAGTTTTAAGCTTAATTTCTGTGGTTTTTTTT

 

418

 

45710

 

Contig23027

sgn|E367382/sgn|E304768

643

TC186445

626

Show
Contig23027

Contig23027

 

sgn|E367382/sgn|E304768

 

643

 

TC186445

 

626

 

1231

 

0

 

625

 

99

 

643

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

643

 

sp|P62296|ASPM_SAIBB Abnormal spindle-like microcephaly-associated protein homolog

 

3469

 

81

 

3.00E-14

 

196

 

36

 

643

 

SGN-U333149

 

643

 

1275

 

0

 

643

 

100

 

643

 

P62296|ASPM_SAIBB Abnormal spindle-like microcephaly-associated protein homolog - Saimiri boliviensis boliviensis (Bolivian squirrel monkey)

 

3469

 

81

 

3.00E-15

 

196

 

36

 

643

 

AT2G31900.1 | Symbol: None | myosin family protein, contains Pfam profiles: PF00063 myosin head (motor domain), PF01843 DIL domain, PF00612 IQ calmodulin-binding motif, PF02736 myosin N-terminal SH3-like domain | chr2:13567837-13576700 REVERSE | Aliases: F20M17.6, F20M17_6

 

1556

 

54

 

1.00E-07

 

192

 

28

 

CAAAAGCATGCCGTTTTGGAAATACAACGGTTTGCAAGAGGAGCCATTACTAGAAAGAGGCTCTTAGGGGCCTCTTGCTACCGCAACGTCTCAAAATTGGGTTACCAGGCTCTTGAACTTAAAATACTACTGCAAGCAGTAGTAAAGTTGCAAAGGTGGTGGCGATGTAAATTGCTTCATGCACAGAGAACAAAAGCCACAGTTGTCATCCAATCGCATGTTTTAGGATGGATTGCCTGGAAACGTGCTTCAAGAAGCAAGGAACGATTACTTCAAGCAGTATTAAAGTTGCAAAGGTGGTGGAGAAGTAAATTGCTTCATGAACAGAGAACAAAAGCAGCAGTTGTCATCCAATCACATATCCTAGGATGGTTAGTCCGGCAAAGTATTTCAAGAAATAAGGACCAATTACTTCAAGCAACATTGAAGTTGCAAAGGTGGTGGAGAGATAAATTGCTTCATAAACAGAAAACAAAAGCAGCAGTTGTCATCCAATCGCATGTCCAAGGATGGAAAGCTCGACAAAGTGCTTCAAGGAAGAAGCACCTAACGTTGCTAGCAGTATTAAAGTTGCAAAGGTGGTGGAGAGGAAAATTACTTCATAAACAGAGAACAAAATCAGCAGTTGTCATCCAATCGCATG

 

643

 

45711

 

Contig23028

sgn|E367550/sgn|E283772/sgn|E203173/LB12DB08

744

TC179075 similar to UP|Q93Z16_ARATH (Q93Z16) AT4g21150/F7J7_90, partial (9%)

517

Show
Contig23028

Contig23028

 

sgn|E367550/sgn|E283772/sgn|E203173/LB12DB08

 

744

 

TC179075 similar to UP|Q93Z16_ARATH (Q93Z16) AT4g21150/F7J7_90, partial (9%)

 

517

 

1011

 

0

 

510

 

100

 

744

 

AK101333|Os01g0911200 Ribophorin II family protein.

 

698

 

97

 

9.00E-21

 

112

 

50

 

744

 

ref|NP_001045159.1| Os01g0911200 [Oryza sativa (japonica cultivar-group)]

 

698

 

97

 

6.00E-19

 

112

 

50

 

744

 

SGN-U315734

 

2387

 

1066

 

0

 

562

 

99

 

744

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

744

 

AT4G21150.1 | Symbol: None | ribophorin II (RPN2) family protein, contains Pfam domain PF05817: Ribophorin II (RPN2) | chr4:11278439-11283858 FORWARD | Aliases: F7J7.90, F7J7_90

 

691

 

86

 

3.00E-17

 

112

 

46

 

AACTAGTCTCGAGTTTTTTTTTTTTTTTTCCCCAGCCATAGGGCAACACATAACATATCCAAATCATCTTTAAGTGATATTCTCACATTTTATCGTCAATGTGTGCTACTTCCACTTCTAGTAAATGTAGTCATCACACATATTTTAGCAGCCCAACATTCACTACACTCTTCAGTCTTCACTACACCAAAGAGAACAATAGGCACCTAAGATGCCCTTCGTGCAAAAGCAGCAGCAGCATCAAAATTGAATTTTTCCCAATTACTGTGGACTATATATCCGATACATTTATGTCATAAATAATTTGTCCTACAAAAAAGATATGGGTATATCGACCCTCTTTTCTCTTGACGAACCCTGCTTCCTCACATTTATAGGTGTTAAAGCTAAATCAATCTATCTAAATCAGGCAGATTTCAACTTGGCAGATGTGGATGCCAGATGTGAAAGGGTTCTGTGTCCAACAAACAGTAAGAAGATCCCTAAGAATCCAAGTGCTTTCAGTGTTGTGAACAGATTCAACTTCAACCAGAACAGAGAATAAAGTGACAGAACGGCCACAATGGCAAGGTGAAAAAGGATGGCAAATGCTGCAGGTGCTGATGCTGTTGGGAAGTTCTTCAGGTTCACACGTAGTCTCAAAAGCCCAACCAAAAATCCAACGAATGGCAAAAGAACAAGGGCCAGAAATGCATAAGAAAGGTTGCTCGGAGGTCTTTTCTCTGGAGCCCTAAAAATGTGAGC

 

744

 

45712

 

Contig23029

sgn|E367448/sgn|E367551

421

TC183650 similar to UP|Q5XWL3_SOLTU (Q5XWL3) Gag-pol polyprotein-like, partial (7%)

425

Show
Contig23029

Contig23029

 

sgn|E367448/sgn|E367551

 

421

 

TC183650 similar to UP|Q5XWL3_SOLTU (Q5XWL3) Gag-pol polyprotein-like, partial (7%)

 

425

 

785

 

0

 

421

 

98

 

421

 

Os11g0524800|Os11g0524800 Integrase, catalytic region domain containing protein.

 

610

 

87

 

5.00E-18

 

133

 

33

 

421

 

gb|ABE88322.1| RNA-directed DNA polymerase (Reverse transcriptase): Peptidase aspartic, active site: Ribonuclease H: Retrotransposon gag protein: Retrovirus capsid, C-terminal [Medicago truncatula]

 

2347

 

184

 

1.00E-45

 

139

 

61

 

421

 

SGN-U332779

 

435

 

793

 

0

 

421

 

98

 

421

 

P03360|POL_AVIRE Pol polyprotein [Contains: Reverse transcriptase/ribonuclease H (EC 2.7.7.49) (EC 3.1.26.4) (RT): Integrase (IN)] (Fragment) - Avian reticuloendotheliosis virus

 

473

 

70

 

3.00E-12

 

107

 

35

 

421

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GTCGCTTCTAATGGACACATATTTATTTTGGTTGCCATTGATTATTTCACCAAATGGGTGGAAGCATCTTTGTACAAGTCGGTAACCATGAAAGTTGTGATGGATTTTTTTCGCAACAACTTGATATGCAGATTTGGAGTACCAAAATGGATCAATACTGATAATGGGGCAAATATTAATAGTCACTTGATGAGAGATATATGTGAGCAATTTAAGGTCACTCATCGAAACTCAACCGCTTAGCGCCCTCAAATGAATAGAGCTGTAGAAGTCGCCAATAAGAATATCAAGAAGATGCTGAGAAAAATAATTGACAATCACCGAGGTTGACATGAGATGTTGCCATATGATTTATTGGGTTATCGGACGACTATCAAAATGTCGACTGGAGCTACTTTATACTTGCTAGTGTATGGGACAG

 

421

 

45713

 

Contig23030

sgn|E367351/LEFL1004AB08/LEFL2011M20

679

AW399332 similar to PIR|T12185|T12185 transcription factor - fava bean (fragment), partial (12%)

528

Show
Contig23030

Contig23030

 

sgn|E367351/LEFL1004AB08/LEFL2011M20

 

679

 

AW399332 similar to PIR|T12185|T12185 transcription factor - fava bean (fragment), partial (12%)

 

528

 

973

 

0

 

528

 

97

 

679

 

AK102792|Os07g0586700 Conserved hypothetical protein.

 

622

 

173

 

8.00E-44

 

199

 

48

 

679

 

emb|CAA66483.1| transcripteion factor [Vicia faba var. minor]

 

377

 

198

 

2.00E-49

 

189

 

56

 

679

 

SGN-U341783

 

951

 

1187

 

0

 

678

 

96

 

679

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

679

 

AT5G56780.1 | Symbol: None | expressed protein, contains similarity to transcription repressor | chr5:22981491-22983467 REVERSE | Aliases: MIK19.25, MIK19_25

 

488

 

185

 

2.00E-47

 

189

 

51

 

AAAAGTGGAAATAGGAGAGGAAAAAAAGCGGAAATACCAGTGAGTGCAGCTGAAGAGCTCAATGGGAGCTGCTGACAAATCCTTCACCCGTCGGCTCAGACGAGAAGACTGTAAACGCACAAAACATGATTCCTCTTTCTCCCACTGGAAGATTCTGGTTGGGCCTAATGATTGGGAGGATTATTTATTGGGAAAGGAAGGAACAGAGAGATATAGGACTCAGAACCTGCCAAACTGCACCTCCTGCTCTGGAGTTTATGAACTGGGAATAGCTGTGTCACGACGAAAAGCTGGGCGAGAGGCTACCAGACTTGACCCTGATTATATTGTTCCTGTTTATGTTGGAAAATCGAATAATGTTAGAACTAGACTGCAGCAATATGGACGTGTAGGTGCTCATTTAGAGAATGACTATTCCAATAGCGAGCTGCACGTTGGTGAAATAATATCTGGTCCAAAGAGAGCTGGATTATTTACAGAAACATTTTCAAGAGGCTTCTCTATTGTTTATAGGTGGGCACCTATGAATGACAATAAAGATGCAGAGAGAACTGAAGCCCAGCTGCTCGACAAATTTGATTATGCTTGGAATAAAGGTAGTAATGGTGTACGTCGCCACAATGCTGTCCTCCGCAAGCTTGATGGCATTTCAAGAAAAACTCATCTTCCTGCTTTCATC

 

679

 

45714

 

Contig23031

sgn|E367353/LEFL1058CF07/LEFL1094AH06/sgn|E325409/LEFL1060AH12

678

TC189226 similar to UP|COL10_ARATH (Q9LUA9) Zinc finger protein CONSTANS-LIKE 10, partial (14%)

494

Show
Contig23031

Contig23031

 

sgn|E367353/LEFL1058CF07/LEFL1094AH06/sgn|E325409/LEFL1060AH12

 

678

 

TC189226 similar to UP|COL10_ARATH (Q9LUA9) Zinc finger protein CONSTANS-LIKE 10, partial (14%)

 

494

 

745

 

0

 

487

 

93

 

678

 

AK121630|Os06g0298200 Zn-finger, CONSTANS type domain containing protein.

 

407

 

162

 

2.00E-40

 

112

 

65

 

678

 

ref|NP_199636.1| transcription factor/ zinc ion binding [Arabidopsis thaliana]

 

373

 

179

 

7.00E-44

 

113

 

70

 

678

 

SGN-U330404

 

596

 

904

 

0

 

579

 

93

 

678

 

Q9LUA9|COL10_ARATH Zinc finger protein CONSTANS-LIKE 10 - Arabidopsis thaliana (Mouse-ear cress)

 

373

 

179

 

6.00E-45

 

113

 

70

 

678

 

AT5G48250.1 | Symbol: None | zinc finger (B-box type) family protein, contains similarity to CONSTANS homologs | chr5:19578545-19580948 REVERSE | Aliases: MIF21.14, MIF21_14

 

373

 

179

 

1.00E-45

 

113

 

70

 

TTTTTTTAAAAAAAGACTTCCAAAAACAACCCCCACACACAAATAGAGAAAGATATTTTAGAAAGGGTCATCTTTCTTGATAGGAGTTTTCTTCTAACCTTTGAAAAGAAAAAAAAAAGCTGCTGTAAAAGGGGTTATCTGTACTTTGTTTCCCTTTTGTTGGGTTGATTTTTTTGGTCAGCTTCAAGGTTGTAACAGATTCTTGTTGCTTATTGCAGAAGAGTACGAAATCAGTTGAGCAAATCATCTTCTGTTTCGAAAAGTTGTAAACTTTCTTCTTGAAGGTTAAAGATCTGTACATTGATTCTGGTCTAGAATAACTAAGAAAAAATAAATTATGGGTTATATATGTGAATACTGTGGAGAGCAAAGATCAATTGTATATTGCCGGTCTGATGCAGCTTGCTTATGTTTGTCGAGTGATCGAAATGTCCATTCTGCAAATGCCCTTTCGCAACGTCATTCCAGGACGCTTATATGTGAAAGATGTAATTCACAACCAGCAGTTGTTAGATGTGTTGAGGAGAGAATATCTCTTTGCCAGAACTGTGATTGGTCAGGTCATGCTAGTTCTAGTTCAGGTTCATCAATGCACAAGAGACAAGCACTTAATTCTTATACGGGATGTCCTTCCGCTGCTGAACTTTCTAATATCTGGTCATTTTTATTAGATGACCC

 

678

 

45715

 

Contig23032

sgn|E365347/sgn|E367390/sgn|E361360/sgn|E365561/sgn|E365963/sgn|E366587/sgn|E366044/sgn|E365393/sgn|E365979/sgn|E366562

575

TC173059 similar to UP|O49969_SOLTU (O49969) SRE1b, partial (92%)

1794

Show
Contig23032

Contig23032

 

sgn|E365347/sgn|E367390/sgn|E361360/sgn|E365561/sgn|E365963/sgn|E366587/sgn|E366044/sgn|E365393/sgn|E365979/sgn|E366562

 

575

 

TC173059 similar to UP|O49969_SOLTU (O49969) SRE1b, partial (92%)

 

1794

 

880

 

0

 

576

 

94

 

575

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

575

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

575

 

SGN-U312709

 

2419

 

882

 

0

 

577

 

94

 

575

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

575

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TCTTCTCTCCTCTTCCCGCAATATCTTTCATCTCCAGATCTGCTCATCGTTATTTCTCTGCATCTGAATCGGTATGCAGATTCGTGTAAATCGTTCGCCGATCTACAGTTTGAGTATGGTTTCGACTTGTATCGGTCATCATTTCCTTGCAAATCGTAACAAATAGTGCCGATCTATCATTTCTGAGATTTTTCGGTATGAATATTGCTCGGGTTATGGACGATGCTGTTGGCTAGACGAAGATTGGATAGATCTGATGGATTTGTTACGAGATTGAGAGATGTATGACCTTTTCAAGGAGTTCTCGGTGATCTGAGATGATTTTTTGAGTTTTATCGGTTATCATCGTTTCAATCTGGTGATTTTACCGTACCTCTGTTGAGCTTGGTGCAATTGGATATCAGTGGTGTTAGATTTATGCTAGATCTCGGGGATGGTAACGACAAGCTTGAGGTTGTTAGATAAGGTTATCATAGTTTAATTTGTTGTCTATTCTCAGCTCTATTATGAAAATTTGCATTAGTTTTACTGTTATGCATGCATATGTACGAGAAAATAATCAGATTGTAGAGAAA

 

575

 

45716

 

Contig23033

LEFL1065DF12/sgn|E394663/sgn|E290590/sgn|E367557/LEFL1048CG08/LEFL1029CC02/sgn|E325181/sgn|E304303/sgn|E301096/LEFL1077CC03/sgn|E312092/sgn|E373345/sgn|E373433/sgn|E306039/sgn|E306038/sgn|E299398/sgn|E373432/sgn|E373344/sgn|E398252

1313

TC176366 similar to RF|NP_564409.1|18398586|NM_103012 oxidoreductase/ zinc ion binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (86%)

1929

Show
Contig23033

Contig23033

 

LEFL1065DF12/sgn|E394663/sgn|E290590/sgn|E367557/LEFL1048CG08/LEFL1029CC02/sgn|E325181/sgn|E304303/sgn|E301096/LEFL1077CC03/sgn|E312092/sgn|E373345/sgn|E373433/sgn|E306039/sgn|E306038/sgn|E299398/sgn|E373432/sgn|E373344/sgn|E398252

 

1313

 

TC176366 similar to RF|NP_564409.1|18398586|NM_103012 oxidoreductase/ zinc ion binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (86%)

 

1929

 

2553

 

0

 

1288

 

100

 

1313

 

AK104537|Os10g0159800 Zinc-containing alcohol dehydrogenase superfamily protein.

 

403

 

481

 

1.00E-136

 

384

 

63

 

1313

 

ref|NP_001064203.1| Os10g0159800 [Oryza sativa (japonica cultivar-group)]

 

403

 

481

 

1.00E-134

 

384

 

63

 

1313

 

SGN-U318725

 

1313

 

2583

 

0

 

1303

 

100

 

1313

 

P25141|ADH1_PETHY Alcohol dehydrogenase 1 (EC 1.1.1.1) - Petunia hybrida (Petunia)

 

382

 

353

 

8.00E-97

 

375

 

46

 

1313

 

AT1G32780.1 | Symbol: None | alcohol dehydrogenase, putative, similar to alcohol dehydrogenase GB:CAA37333 GI:297178 from (Solanum tuberosum): contains Pfam zinc-binding dehydrogenase domain PF00107 | chr1:11869809-11872774 REVERSE | Aliases: F6N18.16, F6N18_16

 

394

 

479

 

1.00E-135

 

386

 

61

 

CCCTGCAGTTTGCATAAATTGACTAGGAAAGAAACCAAAATTGAAACATGGCTCCAAAGGGCAAGGTCATCAGTTGCAGAGCTGCTGTAGCGTATGGTCCAGGGCAGCCGTTGGTGGTAGAACAAGTGCAGGTAGATCCACCTCAGAAAATGGAGGTCCGAATTAAGATTCTCTTTACTTCCATCTGTCACACGGATCTCAGTGCTTGGAAAGGCGAGAGCGAAGCTCAACGAGCTTATCCTCGAATTCTGGGACATGAAGCATCGGGAGTGGTGGAGAGCGTGGGAGAAGGTGTAATTGACATGAAAGAGGGAGATCAAGTCGTAGCGATTTTCAATGGTGAATGCGGAGAGTGCATATATTGCAAATCATCAAAGAAAACCAACTTGTGTGGCAAGTTCCGCGTCAATCCATTCAAAAGTGTGATGGAAAGTGACGGAAAATGCAGGTTCAGGAACAAGGATGGCATACCCATTTATCATTTTCTTAGTACTTCAACATTCACCGAATACACTGTTGTTGATTCTGCTTGCTTAGTCAAAATTGACCCTCATGCCTCACTTGACAAGATGACCTTGCTTAGCTGCGGCGTATCCACTGGTCTAGGGGCTGCGTGGAACACGGCTGACGTTCAAACAGGGGAAACGGTGGCAGTCTTTGGATTAGGAGCTGTTGGTTTGGCCGTTGTTGAAGGGGCACGGACCAGAGGCGCCTCAAAGATCATAGGGGTGGATATTAACCCTGAAAAACGTATTAAAGGTGAAGCAATTGGAATTACTGACTTCATCAATCCCAAAGAAATCGATGTGCCCGTCCATGAGAAAATAAGGGAAATGAGCGAGGGGGGCGTGGACTATAGCTTTGAGTGTGCTGGAAATATGCAAGTTCTTCGAGAGGCATTTTTATCCACACATGATGGATGGGGCATGGCAATCGTTTTAGGAATTCATCCGACACCAAAATTGCTATCACTCCATCCAATGGAACTGTTCGATGGCAGAAGGATTGTGGCTTCTGTCTTTGGTGACTTCAAAGGAAAATCCCAACTCCCTTTTTTAGCTGAACAATGCATGGCTGGGGTGGTCAAATTAGACGAGTTTATTACTCACAGACTACCATTTGAGAAGATCAATGAAGCTTTTCAACTGCTTCTCGATGGCAAATCCTTGAGATGCCTTCTTCATCTTTCCTAATAGTAACAAATTTATTAAAGCAATTCCTCCTATCCTGTATTCTATTATTCTGCACTTTCAAATATATTGTATTTACTTTCTACATGTTTTATCAATGGAGTAAATTTTATAAAAAAAAAA

 

1313

 

45717

 

Contig23034

sgn|E367419/sgn|E318622

550

TC175598 weakly similar to UP|Q9ZVB0_ARATH (Q9ZVB0) F9K20.3, partial (12%)

589

Show
Contig23034

Contig23034

 

sgn|E367419/sgn|E318622

 

550

 

TC175598 weakly similar to UP|Q9ZVB0_ARATH (Q9ZVB0) F9K20.3, partial (12%)

 

589

 

1017

 

0

 

550

 

98

 

550

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

550

 

ref|NP_683507.1| unknown protein [Arabidopsis thaliana]

 

385

 

58

 

2.00E-07

 

82

 

39

 

550

 

SGN-U319099

 

550

 

1049

 

0

 

550

 

98

 

550

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

550

 

AT1G78915.1 | Symbol: None | expressed protein | chr1:29672533-29676100 REVERSE | Aliases: None

 

385

 

58

 

3.00E-09

 

82

 

39

 

TTGCAGGGACTCACTTTACTGTTGTTCAGCAGCCGCAAGTGTTGTTTGCTCCTAAGTCTTGCAGTATTTATAGTCGAACATTCTCTTTCCCTAGTGGTAAAAGCCGGAGCAATCATCAGTTCCAGTTTCAGTACCATACCAAGTCCAAGTATGGGGTTCTGAATTGTATATGCTGCTCTACTGATTCAAATTCAAGTCGTGGTTTCGGTCCGAGTGATGGCAACACTAACAAGGTATTGCTTCACCCTTTTAATTTTGTAATGGATAATTTCGATACTCTTCTTGCTACTTAAATTCAGGGTAAGAATTCTGCAACCGCCAGAAGGCAGGCCAAGGGCACAGTGCGGCCGCAAAGGAATTCATCTACCCGACAGTCAGACGACCTCCTTAATCAGGCACCTCGTTTGAACTCTACGAATGATGTCAGAAAGTCAAAAAGTGTGGGGTCAGATCTTCACTTTGAGGAACGGTTGGATGTAGTAAAAAGGTCGGCGCTTCATCAGAAAAAAACATAGGAAGAGAAAGCATATGGAGCAATTGACTATGATGC

 

550

 

45718

 

Contig23035

sgn|E367425/FC09AG03

792

TC184974 similar to RF|NP_566742.1|18404002|NM_113306 DNA binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (76%)

771

Show
Contig23035

Contig23035

 

sgn|E367425/FC09AG03

 

792

 

TC184974 similar to RF|NP_566742.1|18404002|NM_113306 DNA binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (76%)

 

771

 

1447

 

0

 

767

 

98

 

792

 

AY224545|Os03g0143600 Inhibitor of growth protein 1. Splice isoform 2.

 

253

 

160

 

7.00E-40

 

120

 

63

 

792

 

ref|NP_566742.1| DNA binding / protein binding / zinc ion binding [Arabidopsis thaliana]

 

234

 

268

 

2.00E-70

 

225

 

60

 

792

 

SGN-U333323

 

807

 

1479

 

0

 

767

 

99

 

792

 

Q9D8Y8|ING5_MOUSE Inhibitor of growth protein 5 - Mus musculus (Mouse)

 

240

 

132

 

2.00E-30

 

232

 

33

 

792

 

AT3G24010.1 | Symbol: None | PHD finger family protein, contains Pfam profile: PF00628 PHD-finger | chr3:8675965-8678227 REVERSE | Aliases: F14O13.20

 

234

 

268

 

3.00E-72

 

225

 

60

 

TTGAGTTTTTTTTTTTTTTAAAGATTAAAAATATGTTGAGCTAATTCTAATCGAAGCCCATATTAGGGCTTCAAACTCAAAATCAATAATTCATCGTTAGCTGTTTAAAATTCTCAGAAAAATGTCATTCATCGAAGAATTTCAAGCCAATATCGAAGCTCTTCCGAACCATTTGCGGAGGAAGTATGCGTTGCTGCGTGATTTGGATAAAAGTCTGCAAGGAGTCCAGACCCAAAATGAACAACGTTGTGACAAAGAAATAGAGGATATGATACAGCGTATTAAGGCTGGTAATGTGACACCAGACTCTTCACTAATCAAATTCTCTGACGATGCATTGGATGAGCAAAAGCATGCAATCAGGATTGCTGATGAAAAAGTTGCACTAGCTTCTCAGGCATATGATCTGGTAGATGCTCATATTCAGCAGCTTGATCAGTACTTGAAAAAGTTTGACGAAGATCTCCGGAGAGAACGGGATACTGCTGTTGTTACTGGAGCTCCTGCTACCACTGTTGAAAATAATGTCAAATCTGGAAGGTCTGGTGAGGGTAAGGGAGGGCGTAAAAAAACACGTCTTGCTACAGCAGCTGCAGCTACAGCCACTGCAGCAACACCAAGTGGAATGGATTTGGATCTGCCTGTTGATCCAAACGAACCAACATACTGTTTCTGCAATCAAGTTAGCTATGGTGAAATGGTTGCTTGCGACAATCCTAATTGCAAAATAGAGTGGTTCCACTACGGCTGCGTTGGCCTCAAAGAACAGCCCAAGGGGAAATGGTTTTGCGC

 

792

 

45719

 

Contig23036

sgn|E365705/sgn|E269255/FA23BG06/sgn|E538431

844

TC188704 similar to UP|Q9SYH5_ARATH (Q9SYH5) F15I1.27, partial (14%)

663

Show
Contig23036

Contig23036

 

sgn|E365705/sgn|E269255/FA23BG06/sgn|E538431

 

844

 

TC188704 similar to UP|Q9SYH5_ARATH (Q9SYH5) F15I1.27, partial (14%)

 

663

 

844

 

0

 

450

 

98

 

844

 

AK073830|Os02g0480900 Ataxin-2, N-terminal domain containing protein.

 

591

 

150

 

1.00E-36

 

123

 

57

 

844

 

gb|AAD25791.1|AC006577_27 F15I1.27 [Arabidopsis thaliana]

 

665

 

181

 

4.00E-44

 

172

 

54

 

844

 

SGN-U337451

 

895

 

1645

 

0

 

830

 

100

 

844

 

P53297|PBP1_YEAST PAB1-binding protein 1 - Saccharomyces cerevisiae (Baker's yeast)

 

722

 

84

 

7.00E-16

 

118

 

44

 

844

 

AT1G54170.1 | Symbol: CID3 | ataxin-2-related, similar to SCA2 (GI:1770390) (Homo sapiens): similar to ataxin-2 (GI:3005020) (Mus musculus). Member of a family of PAM2 motif containing proteins. | chr1:20224727-20229613 REVERSE | Aliases: F15I1.27, F15I1_27, CID3

 

587

 

181

 

5.00E-46

 

172

 

54

 

GCAATTGGAACGCTGGGTACCTGATGATGATGCTCCTGAATGTCCTGATCTGGACAATATATTTGATGACCATTGGAATAGGGGCTGGGATCAGTTTCAAGCCAATGAAACACTGTTTGGAGTAAAAAGCACATTTGATGAGGACCTTTATACGACAAAGCTTGAGAGAGGTCCTCAGATGAGTGAGTTGGAAAAAGAAGCTCTAAGAATAGCTAGAGAAATTGAAGGTGAGGATACACGTGATCTTCATCTAGCAGAGGAGAGAGGGATCCAACTTCATGAGAACCTAGAAGTGGACGAGGAAACCAGATTTTCCGCAGTTGTTAGAGAGATTGATGATAGCGGCTATGACAACTGTGAGGACATCCTGTTGGATTCACGTAATGATGAGACATTTCAAGGTATATCTAGTGCTATGGGGAAGTCATTTACTGACATGGGCAGAAGGAAAATGAATGATGGTGCACAAGTTTCATTAAGATCTTCCTTCATGGTATAATTTTGTTTACCCACATTCATTAGTCTTTAAGAATTGTTTGTTGCGGTACTGAGGCTTTTTCCTTCTGTTAAGATAGGGATGACAGAGGAAGATATTGTCATATTAGTCAAGTATCTCAAGCTAGTCGGAAAATATATCAATTGGTTGTTGTCTGCTATTGCTGGTGAATTTAAGAGTTATCCACGTCTTAGATACCAAGCACTTTCAGTGTGAATCATGTGGTTTAAGAGCCTATAAATAATACTTTAGCTTCTGTGTACTCGACTATAGTAAATATAAGCTAATTATATGACGCATTTTAGTATTTCTATTCCTATCTTGCCCCTAGGATGAAGTGCAATCTTC

 

844

 

45720