KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Contig23007

sgn|E366860/sgn|E326317/sgn|E265480

685

TC181735

618

Show
Contig23007

Contig23007

 

sgn|E366860/sgn|E326317/sgn|E265480

 

685

 

TC181735

 

618

 

1191

 

0

 

612

 

99

 

685

 

AK099862|Os01g0681000 Protein of unknown function DUF1298 domain containing protein.

 

531

 

107

 

1.00E-23

 

179

 

34

 

685

 

gb|ABE81356.1| conserved hypothetical protein [Medicago truncatula]

 

471

 

243

 

7.00E-63

 

227

 

52

 

685

 

SGN-U329504

 

685

 

1358

 

0

 

685

 

100

 

685

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

685

 

AT3G49190.1 | Symbol: None | condensation domain-containing protein, contains Pfam profile PF00668: Condensation domain | chr3:18242861-18245370 REVERSE | Aliases: F2K15.50

 

522

 

94

 

6.00E-20

 

169

 

35

 

TTGAAGAAGAAGAATACTATGATGAAACGTCGTCGTTCCCCGTTAGCCCTACCGGGCAATATTTTACGAGCTCAGTTATGTCGATTTCTGTTATTTGTGTGTTGGAATCTGAAATTCCGATCGATGATTCTTGTACCATTACATTGCTTAAGGATGTTTTTATTCCTATAAATCCTCGTTTCTCTTCTATTATGGTGAAAGACAAGAATGGAGTGAAACAATGGAAGAAAGTAGAAGTGAAGCACAAAGACCACATAAATGTACCAATTTTTCCACAAGGAAAATCAAAAGAATTTTATGATAATTGTTTCAATGAATACATGACAAAAATTTCTATGGAACAATTCCCACAAAGTAGACCACTATGGGAAATTCACATATTCAAATATCCAACAACAAAATCAGCTGGAAATTTAGTGTTTAAACTTCATCATTCACTTGGTGATGGATTTTCACTAATGGGTGCACTTCTTTCTTGTTTACAAAGAGCTGATAATCCTTCACTTCCCTTAACATTTCCATCATTTACTAGTAATAATAATAATTATAATCACAATTTGGAAAGTGATTACAAGAAGAGGTTATGTACTAATGTGGTTCAAAGGGTTAATGGGGTTGGTAACACTTTGTTAGATTTTGGATGGAGTTTAATGAAAAGCACTAATCTTGAAGATGAAAGAACATC

 

685

 

45691

 

Contig23008

sgn|E367004/sgn|E208837/sgn|E317030/sgn|E340924/FA31AG11/sgn|E202726/sgn|E548265

1611

TC190087 similar to UP|Q2PQR5_OLIPU (Q2PQR5) GAGA-binding transcriptional activator, partial (55%)

1296

Show
Contig23008

Contig23008

 

sgn|E367004/sgn|E208837/sgn|E317030/sgn|E340924/FA31AG11/sgn|E202726/sgn|E548265

 

1611

 

TC190087 similar to UP|Q2PQR5_OLIPU (Q2PQR5) GAGA-binding transcriptional activator, partial (55%)

 

1296

 

2161

 

0

 

1139

 

98

 

1611

 

AK070616|Os06g0130600 GAGA binding-like domain containing protein.

 

331

 

286

 

3.00E-77

 

346

 

47

 

1611

 

gb|ABL10371.1| GAGA-binding transcriptional activator [Medicago truncatula]

 

318

 

360

 

1.00E-97

 

315

 

59

 

1611

 

SGN-U314168

 

1611

 

3033

 

0

 

1579

 

98

 

1611

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

1611

 

AT5G42520.1 | Symbol: None | expressed protein | chr5:17017511-17019835 FORWARD | Aliases: MDH9.22, MDH9_22

 

342

 

345

 

6.00E-95

 

349

 

56

 

TGAAATCTGCTCCTGTGATTGCCTTAGCTTTCCATAATTCACAACTAATGTATGCTTCTATTTTCCTCATTTGGGATGGGTTTTTTTTATATGAAGTCGAGATAATTCTAATGTCCGGTGTCTAATGGAACAACATATGTGTATTCTACCATGACCAAAGCATTACAAATCTTGTGTTCTTTTCTCATTTCTGCTTCCTTATGTTTCTTTAGGGTCGACGGAGCTAATGATGAGTGCTCGTCTTTCAGGTTCTTTATGATTCAGCCTTGACTAAGAGAATGCAGATCTGAACTGTTGGTAGTCGGTGTTGGTTTTTCCTTGATGAGTATATGTCGGTTCAGTTGGATTGAGGGCTGACGCTTATTTTGACATTAACTACCTGCATATATCATATGGATGACAGCGGGAATCGCGATAATGGAAGGCATAAACCACCTCAGGGTCAGTGGTTGATGCAGCATCAGCCATCAATGAAGCAGATAATGGCCATCATGGCAGAAAGAGATGCTGCCATACAAGAGAGGAATCTGGCCCTTTCTGAAAAAAAGGCTGCCTTGGCAGAGCGTGACATGGCTATCCTGCAGCGGGATTCAGCAATAGCAGAACGAAATAATGCCATCATGGAGCGGGATAATGCCTTTGCTACACTTCAGTATCGTGAAACCTCTATGACTGCTGGTCAGATTGTCCGTGGAGTGAAACATATGCACCATCCTCAGCAACATGTACATCACCAGCCACATATGGGAGAACCAACATATAACCCCAGAGAAATGCACATGGGTGAAGCCATACCAGTTTCCCAACCTGCTCCGGAGCCAGCAAAGCCCCGTCGAAACAAAAGAGCCAAGGAGCCAAAGGCAGCAACAGGTTCCAAGAAGACTCCAAAAGCATCAAAGAAAGTAAAAAGGGAAACTGAAGATCTTAACCAAACCACATATGGCAAGTCTCCAGAGTGGAAGGGTGCGCAAGAGATGGTTGGGGCAAGCGATGACCTTAACAGACAGTTATCTGTGGCAAAACCCGACTGGAAGGATCAGGACCTCGGGCTCAATCAAGTTGCTTTTGATGAAACAACCATGCCAGTCCCAGTCTGTTCCTGCACCGGAGTCTTGAGACCTTGCTACAAATGGGGAAATGGAGGTTGGCAATCTTCATGTTGCACAACCAATTTGTCGATGTATCCTCTACCAGCTGTTCCCAACAAACGACATGCTCGAATTGGTGGTAGAAAAATGAGTGGAAGTGCATTCACCAAGCTGCTTAGTCGTCTGGCAGCCGAAGGCCATGATCTATCAAATCCAGTTGATCTTAAGAACAACTGGGCAAAGCATGGGACGAATCGCTACATCACCATCAAGTAATGCTTCCAAAGTCTTCAATCTAGGACGGTATACCTCAACATCGTTTACATATTATGTTTTCTGTTCATCAACTTCCTTTAGCCCCTATGTAAGTTTGTCATCGTTCTAAAATGTTAGCTGGATTCGGAGTTGGATCAACGAGAGATAACTGTAAAGAAGCCTGTATTCAGGATACTTTGCAACAACGTTGATGTTAAATGTATTGAATATCTAGTAAAAAAGAAAAAAAAAAACTCGAGGGGGGCCC

 

1611

 

45692

 

Contig23009

sgn|E366786/sgn|E297114/LEFL2009E19/sgn|E541829/sgn|E332241

1097

TC190288 similar to UP|Q7XJ53_ARATH (Q7XJ53) At3g06270, partial (36%)

1021

Show
Contig23009

Contig23009

 

sgn|E366786/sgn|E297114/LEFL2009E19/sgn|E541829/sgn|E332241

 

1097

 

TC190288 similar to UP|Q7XJ53_ARATH (Q7XJ53) At3g06270, partial (36%)

 

1021

 

1384

 

0

 

741

 

98

 

1097

 

AK068697|Os02g0281000 Protein phosphatase 2C family protein.

 

1086

 

149

 

3.00E-36

 

150

 

47

 

1097

 

ref|NP_187278.2| catalytic/ protein phosphatase type 2C/ protein serine/threonine phosphatase [Arabidopsis thaliana]

 

348

 

224

 

8.00E-57

 

172

 

65

 

1097

 

SGN-U325954

 

1034

 

1413

 

0

 

740

 

98

 

1097

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

1097

 

AT3G06270.1 | Symbol: None | protein phosphatase 2C, putative / PP2C, putative, similar to protein phosphatase-2C (PP2C) GB:AAC36699 (Mesembryanthemum crystallinum): contains Pfam profile: PF00481 protein phosphatase 2C | chr3:1896143-1898040 FORWARD | Aliases: F28L1.21, F28L1_21

 

348

 

224

 

9.00E-59

 

172

 

65

 

TAGTCTCGAGTTTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTCTGGGTTATCTTCATTTTCAATTTGATTATATTCCCCCAAAAATTACATCTTTTTTTCTATCAACAAATCTTCTTTTTCTTGGAAATTATGTTTGATTTTTTCTTCTTCACAGACCCCACAAACAACACATCTTCTTAATCTTTCTTTTACATAAAAAGTCATTCTTTGATCACCCCTTAAAGTTTTCTTTTTTCTTTTGCTTCTTCTTTGGGGGTTCCCTTCTTGTATTGCAATCTTTCTTTATCGTTTCTTCTTCATTGGGTTTTGGGGTTGTTTCCAATCTTGGTTTCTTTATAAGTTTTTTCTTTTCTTTTCTGACAACCCCCCAAATTCTATTCCTAGACCAAAATCCTTGTTTGGGTGTCTTGGTATTAGGGTTTGTTTTTTCTTGTTGGCTTTTATGTATCACAGGTTTGAATAAAAAAAAACCCATTTTTGGAAAAAACAATGCTGTAAATGGGTTATGCAGATTTGGTTTTATTAAGTTTTTAGACCTGGTTGAGTAATTTTTACAAATAATTGGTGTGCAGCTTTGTTTGGATTGAGATATGGGGTGTGTTCATGGGAAGTGTTGTTGTAGATATCCAAGATCTTCAGATGGTGATAATAGGGAAGATTTGGGTAGATATGCTCAGGTTCAAACACATATTCTTGCTGGAAGGTCTGTTGAAAGTGCTCAAGTTCCTTCCCATAACTTCAGGTTAGAGTATTCGGTGCTTACGCAGCGCGGGTTTTATCCTGAATCACCTGAGAAAGAAAATCAGGATAGTTATTGTATAAGAACACAGCTTCAGGGTAATCCAAATGTTCATTTCTTTGGGGTGTTTGATGGGCATGGACAGTTTGGTACTGAATGTTCTGTGTTTGTTAGGGATAGGCTTGTTGAGATTTTATCAAATGATTCTACATTGTTAGATGACCCTGTTAAGGCTTACAATTCTGCATTTTCAATAACAAATGAAGAACTTCATGATAGTGAGATTGATGATTCCATGAGTGGGACAACTGCTATAACTGCTCTTCTTGTTGGAGACATGTTGTATGTGGCTAATGT

 

1097

 

45693

 

Contig23010

sgn|E367008/sgn|E365443

580

TC178759 similar to UP|HIS6_PROMP (Q7V2P2) Imidazole glycerol phosphate synthase subunit hisF (IGP synthase cyclase subunit) (IGP synthase subunit hisF) (ImGP synthase subunit hisF) (IGPS subunit hisF) , partial (5%)

583

Show
Contig23010

Contig23010

 

sgn|E367008/sgn|E365443

 

580

 

TC178759 similar to UP|HIS6_PROMP (Q7V2P2) Imidazole glycerol phosphate synthase subunit hisF (IGP synthase cyclase subunit) (IGP synthase subunit hisF) (ImGP synthase subunit hisF) (IGPS subunit hisF) , partial (5%)

 

583

 

1088

 

0

 

549

 

100

 

580

 

AK105428|Os01g0788900 TPR-like domain containing protein.

 

670

 

86

 

2.00E-17

 

203

 

32

 

580

 

ref|NP_177089.2| unknown protein [Arabidopsis thaliana]

 

658

 

168

 

1.00E-40

 

198

 

46

 

580

 

SGN-U330765

 

580

 

1150

 

0

 

580

 

100

 

580

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

580

 

AT1G69290.1 | Symbol: None | pentatricopeptide (PPR) repeat-containing protein, contains Pfam profile PF01535: PPR repeat | chr1:26051035-26053011 REVERSE | Aliases: F4N2.25

 

658

 

168

 

2.00E-42

 

198

 

46

 

TGGAGAAGAGCTCTCTGTAGTCTCTCAAAAAGACCCTTTTCTTCACAACCTGAAACACCCACTTTGTATTCCTTTCTCCAGCCTTCAATTTTCTCCTTAAAAACAACTGAATCGCCTTCTACAACCCCACCAAAACCCCATGACCAAACCCCTCTAACCTTAACACAAGAACACAAATCTAATCTTGAATCCACTCTTCTAGATTCAATCAAAAGTAACAATACAGATGGAGCATGGAAATCATTCAAGACTCTTTCAAATTACTCTGCTTTCCCAAGTAAGTCACTTACCAATTCAGTAATCATTCATCTGTCATCATTGAATGATACCCTTAACATAAAAAGAGCATTTGCATCAGTAGTTTTCTTGTTAGAGAAGAAACAAGAATTGTTAAAGCCTGAAACTGTACATGTACTGTTGAATTCAATGAGGGATGCTAATAGTGCTGCCCCTGCTTTTGCTTTGGTGAAGTGTATGTTCAAGAACAGATATTTCATCCCTTTTAGTCTGTGGGGTGATGTTCTTGTGGAGATTTGTAGGAAAAATGGTAACTTTGGTGGGTTTTTACAAGTTTTTAATG

 

580

 

45694

 

Contig23011

sgn|E366935/sgn|E289542/LEFL2012O10/LEFL2036L21/LEFL2029J22

709

AW398429

565

Show
Contig23011

Contig23011

 

sgn|E366935/sgn|E289542/LEFL2012O10/LEFL2036L21/LEFL2029J22

 

709

 

AW398429

 

565

 

1029

 

0

 

551

 

98

 

709

 

AK063322|Os12g0145400 Protein of unknown function DUF231 domain containing protein.

 

436

 

223

 

1.00E-58

 

124

 

79

 

709

 

ref|NP_566270.1| unknown protein [Arabidopsis thaliana]

 

346

 

224

 

4.00E-57

 

201

 

56

 

709

 

SGN-U345993

 

907

 

1269

 

0

 

672

 

98

 

709

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

709

 

AT5G19160.1 | Symbol: None | expressed protein, predicted proteins, Arabidopsis thaliana and Oryza sativa: expression supported by MPSS | chr5:6430727-6432458 FORWARD | Aliases: T24G5.60, T24G5_60

 

464

 

224

 

5.00E-59

 

216

 

53

 

AAAATATTCAATTTTTTTGATAGTCTCCATCCCAAGACTGCATTTTTCTCTACACCCACTACTACTTCTTTAGTCTAAAGCAGAGATGAGTGAAAACCCACCTCCCAGATTCTTCAACACAATGACCCATTTGAAGATTTTCAAGAAACTCAAGCCTTTTGAGCCTTCACCAGGTGTTCTTGGCTGCTTCTTTTTCACCGTTTGCTTATTCTTGTATCTCTTCTTGTTGGATTATACAACAGTAAACAAAGTGCCTCGGTTGCATCAGCCATCCTTGTTAGCTACTTGGGTTGGGATAAATGGATCATCTTTGTCCTATAACAAGGTTGATTTTTTGGGAAGAGGTGCAGAAAGTTGTGATATTTTCGATGGAAATTGGGTTTGGGATGAAAGATATCCACTTTATGAATCAAAGGATTGTAATTTCTTGGATGAAGGCTTTCGTTGTTCTGAGAATGGTAGGCCTGACAATTTCTATACTAAATGGCGTTGGCAACCTAAAGATTGCAACTTGCCCAGATTCGATGCAAAATCTATGTTAGAAAAGTTGCGAAACAGACGGGTTGTGTTTGTCGGAGATTCAATTGGAAGAAACCAGTGGGAGTCTCTACTCTGCATGTTATCTTCTGCTGTTCCTGACAAAAGCAAGATATATGAAGTTAATGGAAATCCTATCACGAAGCACATGGGTTTTTTGATTTTTATGTTC

 

709

 

45695

 

Contig23012

sgn|E367018/LA27BB10/LC01DB09

686

TC189963 similar to UP|Q9SAJ2_ARATH (Q9SAJ2) T8K14.1 protein, partial (4%)

667

Show
Contig23012

Contig23012

 

sgn|E367018/LA27BB10/LC01DB09

 

686

 

TC189963 similar to UP|Q9SAJ2_ARATH (Q9SAJ2) T8K14.1 protein, partial (4%)

 

667

 

914

 

0

 

477

 

99

 

686

 

AK072144|Os07g0438500 Octicosapeptide/Phox/Bem1p domain containing protein.

 

862

 

60

 

2.00E-09

 

225

 

30

 

686

 

dbj|BAF01492.1| putative Ser/Thr protein kinase [Arabidopsis thaliana]

 

1025

 

66

 

1.00E-09

 

164

 

34

 

686

 

SGN-U316275

 

2300

 

880

 

0

 

484

 

97

 

686

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

686

 

AT1G16270.1 | Symbol: None | protein kinase family protein, contains PF:00069 Eukaryotic protein kinase domain. ESTs gb:H37741, gb:T43005 and gb:AI100340 come from this gene | chr1:5563884-5568362 FORWARD | Aliases: F3O9.7, F3O9_7

 

1147

 

66

 

2.00E-11

 

164

 

34

 

CGAGTTTCACTGTTGTAGCAGTTGTTGGAAACGATGTTATACAATCTAAAATTAGTGACAAGAGTCAGGAACAAGTTCAGAGTTCAGCATCTCCTGCAGCTGTTGAGGAAGAAAAACTTGATAGGTTCACAGAAGATGGCTTCTCCGGATCTGGTAGAATATCAAATTCTGGCTATGGAGACTCGGGGGCAAACCTACATGACATTAGCTACGAACAACCATCGATTCCTCCACGAACTTTTCGCTCTGAATGGATACCCAGGGAACAGCCCGGCCTTAATCGTTTATCCAAATCTGATGATTCTGCTGCCTCGCAATTCATAATGGCCCATGCATATTCTGAAGGCTCACAACAGATCATAGAATCCGTTAATAAATTGAACGATGGGAATGTGGCTCCCCAGACTGAGCATTTTGTACCTTCTGGAAGATCTTTGTCTGCTAATCTACATGCTACTGCAGATAAAGGGGTAAAACTTCAGGAATCACAAGGGTTAAGTGTCAGTGCCAGAGAAGTTGATACCAAGTTTAGTGGAGAACTTTCTGAAGCAAATTATAAGCCTGAGCTGAAAGCTGCAACTTATGCAGAGAAAGTGAAATCTGGACTAAGTGATCCTATCTTAAATAATAATATCCAGGCTGAGTCTGCTTCCAGGAAGACAGAGCTTCATTGGGGCGATGCATCT

 

686

 

45696

 

Contig23013

sgn|E367022/sgn|E262545

1133

TC190317 similar to UP|Q9SB46_ARATH (Q9SB46) Rab geranylgeranyl transferase like protein (Fragment), partial (19%)

1135

Show
Contig23013

Contig23013

 

sgn|E367022/sgn|E262545

 

1133

 

TC190317 similar to UP|Q9SB46_ARATH (Q9SB46) Rab geranylgeranyl transferase like protein (Fragment), partial (19%)

 

1135

 

2230

 

0

 

1133

 

99

 

1133

 

AK102430|Os06g0677500 Protein prenyltransferase domain containing protein.

 

691

 

227

 

1.00E-59

 

371

 

37

 

1133

 

ref|NP_194180.2| protein prenyltransferase [Arabidopsis thaliana]

 

678

 

248

 

4.00E-64

 

367

 

41

 

1133

 

SGN-U320168

 

2368

 

2238

 

0

 

1133

 

99

 

1133

 

Q5XI54|LRC48_RAT Leucine-rich repeat-containing protein 48 - Rattus norvegicus (Rat)

 

523

 

52

 

3.00E-06

 

91

 

35

 

1133

 

AT4G24490.1 | Symbol: None | similar to geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related [Arabidopsis thaliana] (TAIR:At5g41820.1): similar to Rab geranylgeranyl transferase, a subunit [Rattus norvegicus] (GB:NP_113842.1): contains InterPro domain Protein prenyltransferase, alpha subunit (InterPro:IPR002088): contains InterPro domain Leucine-rich repeat (InterPro:IPR001611) | chr4:12655069-12658344 REVERSE | Aliases: F22K18.310

 

678

 

248

 

5.00E-66

 

367

 

41

 

TTTATCCGCGGATGGATCGTTTGGAGATTGCTCTTTATCACCCTTTACGAATCTTGAGACTAATACTAGAACACTTCCACTCATTCTCTATTTCAGCGAAGCTGTTGAGAATATATGCTCATCTACAGTAGTAATCGAATGTGAAAATATTGCGAGTAATGAGCTCGTCTGGAGATCACTCTCAGGAGATGGAGCTGGGTCTGCTCAAGCTTGGTTGACATATCTTAATTTCCCAGAGGAACATGCACATTCTGAAAAGGCTTACCAAGTAAAGGTCAGCCTTGCTCGTTCTCGAGGCATTTTCTCTTCAACTGGTGTTCATCATGGAGATTCTTCTCATATTGAATTTTCAGTGTCTGTACCACCTTATCGTTCAGAACATGTTGATTTAAAAAATGAAGGGAAAATCTCTTGGAGTGATGAAAGTTTCTGCACTCATGACACACAGTTTCTTGAGTCAGCTCTGATTAACTTGTTCCATCTGGAAAGAACCAAGATAGATGAAACAGTGGTGGACTATCAGTGGAATATTACGACCATCAATAATGAGATATCACACTATAGGGAGTTGTTATCAACAATGAACTGTAAAATTGGGAAGCTGACACTTGCCAGACTGCTGATTGCCCATGACACCTTAATGTCATATACTGGCACTAGTCACAGAAATGTTAGCCACCATGCAGAAGTTCTTCAACTTTATGACGATTTAAAGAAAATGGACCCAGCACATCTCCACTACTACCAGGATGAGTACAGTATAGTACTTCTGAAACAGACAATCTCCAATCAAGAATTGTTGTTGAAGCACTGCCGTAAATATAGGGATCCATCTTCTCCAAGAATCAATAATTTCTGTCTGCGGCTTAATAATCTCTCACTTTCACGTATTGGGTCTATGGAGCAACTTTTGTGGGTCCAAGTATTAGATCTCAGCCACAACCAACTTAAGACACTTGAAGGCTTGGAGGTGATGCAACTTCTCTCCTGCTTGAATGTTAGCTACAATAAACTCTGCAGTTTTACTGCATTGGAGCCTTTGAAACTGCTAAGGTCACTGAAAGTCTTAGATATCTCTTACAACGAGATTGGAGCGCATTCTATTGACACGAGGAGGTATTTGTGCTCTTCCC

 

1133

 

45697

 

Contig23014

sgn|E335975/sgn|E367460

415

TC184947 similar to UP|Q2R1Z4_ORYSA (Q2R1Z4) Expressed protein, partial (5%)

449

Show
Contig23014

Contig23014

 

sgn|E335975/sgn|E367460

 

415

 

TC184947 similar to UP|Q2R1Z4_ORYSA (Q2R1Z4) Expressed protein, partial (5%)

 

449

 

793

 

0

 

416

 

99

 

415

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

415

 

dbj|BAE71279.1| hypothetical protein [Trifolium pratense]

 

563

 

81

 

2.00E-14

 

97

 

42

 

415

 

SGN-U321290

 

2062

 

815

 

0

 

415

 

99

 

415

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

415

 

AT3G55760.2 | Symbol: None | expressed protein | chr3:20711414-20714035 FORWARD | Aliases: None

 

578

 

79

 

7.00E-16

 

104

 

43

 

TTTGCTCTGCAGACTGCAAACAGAAGGCAGAAATTACGATACTCGAAGTCCGATGGCGACTCGTTTCCCGGCAACTACTCACTCACGCGTCGTCGCGACGAGCTCCGGCGAACCCAAAGTAGAATATCCGTTTTCCGTTTCGACCAGAAAATGGCAAGTAGTAACACAAAGGAGAAGGAAGAGTTCAAGAATCAAAGCTACAGATTCAGATTCATTCTTGGAAATGTGGAAAAGAGCAATGGAACGTGAGAGAAAGTCAGCTGAGTTCAAAAGAATAGCTGAGAACATTGCTCCTCCTGAAGTGGATGAAAGCCCTGAGATATTGGAGAAGAAGACCAAGGAATTCAACAAGATTCTTCAAGTTTCTCCTGAAGAAAGAGATAGAGTTCAAAGTATGCAGATCATTGATCGTGCT

 

415

 

45698

 

Contig23015

sgn|E367568/FA04CA08

584

TC187282 similar to RF|NP_188802.1|15233119|NM_113060 protein phosphatase type 2A regulator {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (55%)

951

Show
Contig23015

Contig23015

 

sgn|E367568/FA04CA08

 

584

 

TC187282 similar to RF|NP_188802.1|15233119|NM_113060 protein phosphatase type 2A regulator {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (55%)

 

951

 

1142

 

0

 

584

 

99

 

584

 

AK103052|Os04g0485100 Protein phosphatase 2A B'kappa subunit.

 

509

 

294

 

3.00E-80

 

193

 

70

 

584

 

ref|NP_188802.1| protein phosphatase type 2A regulator [Arabidopsis thaliana]

 

546

 

316

 

5.00E-85

 

193

 

78

 

584

 

SGN-U328465

 

1355

 

1150

 

0

 

584

 

99

 

584

 

Q9LVE2|2A5Z_ARATH Serine/threonine protein phosphatase 2A 59 kDa regulatory subunit B' zeta isoform (PP2A, B' subunit, zeta isoform) (AtB' zeta) - Arabidopsis thaliana (Mouse-ear cress)

 

518

 

316

 

4.00E-86

 

193

 

78

 

584

 

AT3G21650.1 | Symbol: None | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative, similar to SWISS-PROT:Q28653 serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, delta isoform (PP2A, B subunit, B' delta isoform, PP2A, B subunit, B56 delta isoform, PP2A, B subunit, PR61 delta isoform, PP2A, B subunit, R5 delta isoform, PP2A, B subunit, B'-gamma) (Oryctolagus cuniculus): contains Pfam domain, PF01603: Protein phosphatase 2A regulatory B subunit (B56 family) | chr3:7621578-7624083 REVERSE | Aliases: MIL23.8

 

546

 

316

 

7.00E-87

 

193

 

78

 

AGGTTCAGAAAAGCAAAATCTTTTGATTAGGAAATTACAAATGTGTTGCGTGCTGTTTGATTTTGGTGACCTGACGAAGAATCTGAAGGAGAAGGATGTCAAGAGGCAGACATTGCTTGAATTAGTTGATTATATTTCAGCTGTGAGTTCCAAGTTTAATGAAGTCACAATGCAAGAATTAACGAAAATGGTTGCTACCAATTTGTTTAGGACATTACCTTCGTTTAATCATGACAACGGGCTACTGGATATGTTTGATCCAGAAGAGGATGAGCCCACGATGGAACCCTCGTGGCCTCACCTTCAGGTTGTTTATGAACTTCTTTTGCGATTTGTGGCTTCATCGGAGACGGATGCTAAGCTTGCAAAAAGATACATTGACCACTCTTTTGTCTTGAGATTGCTTGAACTGTTTGATTCAGAGGACCAACGGGAGCGTGAGTACTTGAAAACAATTCTTCATCGTGTATATGGGAAGTTCATGGTGCATAGGCCATTTATCAGGAAAGCCATAAATAATATATTTTACCGTTTTATCTTTGAGACTGAGAAGCACAATGGAATTGCAGAATTGCTGGAGATCT

 

584

 

45699

 

Contig23016

sgn|E367461/sgn|E370993

600

AW399279

498

Show
Contig23016

Contig23016

 

sgn|E367461/sgn|E370993

 

600

 

AW399279

 

498

 

527

 

1.00E-149

 

278

 

99

 

600

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

600

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

600

 

SGN-U330600

 

600

 

615

 

1.00E-175

 

310

 

100

 

600

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

600

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

AACTAGTCTCGAGTTTTATCTTTTTTATTCTTTTCATAAACAATAGATGCATTAAAAGAAAGTTGTGTCTGACATAATTGAAAAATAAAAAGAGTAAGTTGCTTAAGTAGTATTGAATCCATTCTCTATCATCCATGATTGAGAAGGAATCTACTTGCTAGTTTACTACAATCCAAACATATGATATATAATAATAACAAATTACAGAGAAATGAAGATGACCTGAGTCCTAACCATGGTTGACAATCTACTTGAAGAAGTACCCAAGAGACCCCAAAAAATCTCCCAAGGGTAACCAACTTCGTTTTCATTTTTTTTTTTTTTTTTTTTTGTTTTTTTGTTTATTGTTGCATTTTATCCCAGAGGAAAAACCCCTTAAAAAACCCCAAAACCCCGGTTTTTGGCTTTTTCCCAACCCATTTAAATATTTAAAAAAAAAAGTGCTTTTTTTTTAACCCCCAACTAATTTTTCCTTTTGGGCCCCTTAACTTTTTTTATTTTAAATTTCCCCCCTTCCATTTTTTCCCACAATACCCTTTTTGGCTTAAAAGTTTTTTCCCCCTAAAAGCCACCCTTTGTCTTTTTTAAAAAAAAAAAAAA

 

600

 

45700

 

Contig23017

sgn|E367506/sgn|E369196

635

TC182254 homologue to UP|Q42935_NICPL (Q42935) Pectin methylesterase precursor (Fragment) , partial (39%)

1250

Show
Contig23017

Contig23017

 

sgn|E367506/sgn|E369196

 

635

 

TC182254 homologue to UP|Q42935_NICPL (Q42935) Pectin methylesterase precursor (Fragment) , partial (39%)

 

1250

 

1055

 

0

 

592

 

97

 

635

 

AK119642|Os01g0215700 Lipolytic enzyme, G-D-S-L family protein.

 

378

 

184

 

4.00E-47

 

148

 

55

 

635

 

ref|NP_001042396.1| Os01g0215700 [Oryza sativa (japonica cultivar-group)]

 

378

 

184

 

3.00E-45

 

148

 

55

 

635

 

SGN-U313234

 

1284

 

1132

 

0

 

591

 

99

 

635

 

Q7Y1X1|EST_HEVBR Esterase precursor (EC 3.1.1.-) (Early nodule-specific protein homolog) (Latex allergen Hev b 13) - Hevea brasiliensis (Para rubber tree)

 

391

 

106

 

8.00E-23

 

150

 

39

 

635

 

AT1G28600.1 | Symbol: None | lipase, putative, similar to lipase (Arabidopsis thaliana) GI:1145627: contains InterPro Entry IPR001087 Lipolytic enzyme, G-D-S-L family | chr1:10051000-10053103 REVERSE | Aliases: F1K23.28, F1K23_28

 

393

 

176

 

8.00E-45

 

147

 

54

 

TCTCGAGTTCTTTTTTTATTTTGTGTTTTTTGTTGTTCCTTAAGGAGTCCTTCTATAGAAAAATCCCAAATAACCAACGATATTCCGACGGAAATGAAAAATCTTACATATTATTATTATGACAATAATAACGTACTCAGTATATCCCACAACCTTACGTACTCGGTTTAAATTTGTTTGATGGGAGGAAATGTGAGAGATGGTGAAGTGAATGGTCCATTGAGTAATCCTTTGGCTATGTGGTGATAAGCTGCCTCTGTTAAGTGAATTCCATCCCAATTTGTAAAACTTGAAGCATCCAAACATGACTTAAAGCCAATATGACCACATCTTGCTGAATTGTTGAAGTTGTATGGACCTCCACCTCCACAACATGCTACTAGTGTATTGGAAAATCCATAATGCTTTGGGGAATGAATCAATCTCTTGGCAACTCCATAGTAATCAGCATATATGATCTTTGCATGAGGATATTCTTTTCTTAAATTCTCAATTCCTAGTTTTAACTTAGCATTATGATATTTGGAGAAGGCATTATAGGCTTTTAAACATCCATATTTGTCATATGCATCTTTGTTTGTAGTCCCAAATATGGTTAAGAACACTGCTGAGCAACCAATTGGGAGATTCCCAGG

 

635

 

45701

 

Contig23018

sgn|E367462/sgn|E330544/LEFL1098BF12/sgn|E328954/LEFL1097DG10/sgn|E315723/sgn|E209660/LEFL1098DC01/LEFL1015AG07/LEFL1014DB03/sgn|E212567/sgn|E256416/FA13CC11/sgn|E320203/sgn|E546394/sgn|E333034/sgn|E332909/sgn|E322885/sgn|E333710/sgn|E352323/sgn|E546352

2345

TC189810 similar to UP|Q94BZ2_ARATH (Q94BZ2) At1g30970/F17F8_14, partial (51%)

1952

Show
Contig23018

Contig23018

 

sgn|E367462/sgn|E330544/LEFL1098BF12/sgn|E328954/LEFL1097DG10/sgn|E315723/sgn|E209660/LEFL1098DC01/LEFL1015AG07/LEFL1014DB03/sgn|E212567/sgn|E256416/FA13CC11/sgn|E320203/sgn|E546394/sgn|E333034/sgn|E332909/sgn|E322885/sgn|E333710/sgn|E352323/sgn|E546352

 

2345

 

TC189810 similar to UP|Q94BZ2_ARATH (Q94BZ2) At1g30970/F17F8_14, partial (51%)

 

1952

 

3445

 

0

 

1844

 

98

 

2345

 

AK067997|Os09g0560900 Zn-finger, C2H2 type domain containing protein.

 

355

 

318

 

1.00E-86

 

358

 

50

 

2345

 

gb|ABE94278.1| Immunoglobulin/major histocompatibility complex: Zinc finger, BED-type predicted: Zinc finger, C2H2-type [Medicago truncatula]

 

374

 

395

 

1.00E-108

 

355

 

58

 

2345

 

SGN-U315890

 

2225

 

3384

 

0

 

1759

 

99

 

2345

 

O43670|ZN207_HUMAN Zinc finger protein 207 - Homo sapiens (Human)

 

478

 

139

 

5.00E-32

 

87

 

67

 

2345

 

AT1G30970.1 | Symbol: None | zinc finger (C2H2 type) family protein, contains Pfam domain PF00096: Zinc finger, C2H2 type | chr1:11040262-11043732 REVERSE | Aliases: F17F8.14

 

367

 

357

 

1.00E-98

 

355

 

56

 

TCTCCTCCTCCCTCACCCGTTTTTCTCAGAAACCCTAACTCTCTTAAGCGAATAGAGAGAGAAAAACCCCAGTGTTCAATCCCAAATCGCTTTCGGAACCCTAGCGGATCAGCACGCATTGATTTCGTCCGATTTGATTCAATTGCTAAAGGAGGAGCACTTTGGGTTTTCTGGTGAGATAAATGGGGAAGAAGAAGAAGAGGTCAACCGATAAGGTATGGTGCTACTACTGTGACAGGGAGTTCGATGATGAGAAGATTTTGGTTCAGCATCAAAAGGCTAAACACTTCAAATGCCATGTTTGCCATAAGAAGCTTTCTACTGCTGGCGGCATGGCCATTCACGTTCTCCAGGTTCACAAAGAAACCGTCAGCCAGGTACCGAATGCCAAACCCGGTAGAGAGTCTACTGATATTGAAGTATATGGAATGCAAGGAATCCCAAGTGATATCTTAGCAGCTCACTATGGAGAGGAAGAAGATGAGTCCCCAGTGAAAACTGCCAAAGTGGACATTCCATCATCCCAGTATCTTGGTGGTGCATTTCCAGGATATCCTCCCCGGGCAACTTTTGGCGCGGTGCCACCACTCTATAATCCTGCGCTGCCTATGCCTCCTGCTGGTTGGTCAGCCCCCCCTCGCCATCTTCCTTGGTATTCACAGTATCCTGCTGTCTCGGTTCCACCTCCTGCACTGATGGGTCTTCCACAACAACCATTATTTCCTGTGCAACATATGAGGCCTCCAATGCCAGCCACTGCACCACCAACACTTGTTGCTCCTCCAGGGATCCCGACCCCACCTGTTCCCGTATCTCAACCCTTGTTTCCTGTTGTTCCTAATAACAATAACCTTGCCCAAAGTTCGCCATTCTCAGCGCCAATGCTGTCAGCGAGTGTGCCATTCAGCTCTGCAGTTGAAACAAAGAGCTTATTTGACCCAAACATGGGCAACAATGCTCCTGCCGCCATTGGTTATCAGATTTCAGTCTCAGCACCGGTAAATTCACATTCTTATGCCTCTGGCCCAAATACTGCTGGGCCCTCAATTGGTCCACCACCTGTTATTACCAACAAAGCTCCAGCTAACCAACCAGCAACAAATGAGGTCTACTTAGTTTGGGATGATGAGGCCATGTCCATGGAGGAAAGAAGAATGTCCTTACCAAAGTATCAGGTGCATGATGAGACTAGCCAGGTAAGTTATAATTACCTAATACTAGTATTTGTTCCTATGAATATGGGACTTGTGTTGTAGGTTGGTGTTAGTTTCATGTCTCGGATTCAGTTGTTTACTATTCTTTCGTATTCGTAAAGCAAATTTGTAAGTCTTCCCATTCTCCTTCATCTTCTTGGAAATAGCATACTCTTGGATGAGTACACCTGGTAATCAATCAATTTAGTGTATGTTTCAACCCCATTAATTAATGGGCTTCTTTTATCTTCTTTTGGCCATTCTCCGGTTGGCAAGCAATCCCTACAGTTTTGTGGTCATCAATGATTCAAGTATGTATCTTCATTATCTTTTGCTGGTAATTAAGTAATGCCATTTCTAATTACTGTGCTGCCATCCACTCAAGGGGTATCTCAGCAGAGTGCATGTAATTAGTTCTTGGATATTTCCATGTTCACTTTGAGCTTTACTTGTCCTTGAAAGAGTTGGGCTGTGTGAGCAAAGCATGCATAGACCCAACAGATGTTTGCAAATTACTATGATTGTTAATATATTTATGGTCGAAAAGTGGTTCAAATTTGGCCCAGGTCAGATTCTTTTGCCAAGTTCAGAATCTATTGTCATTGAAGCAGGCTATGATTTTGATTCAATACATTTGTGCTGATCACCTAACTTGTTCGCGCTTCTATTCTAAAATTATCTGTCTGTGTTTTCTTTTTTCAGATGACGTCAATAGATGCGGCAATAGACAGAAGAATATCAGAAAGCAGACTTGCAGGGCGCATGCCTTTCTAGACCTGACCGTTTTTGCTCTGGTTGGCAGGGTGCTCTCTGAGTTGTAGGAAATTGTTCAACTGACCAAAGTTTTGCTTCAGAAAAAAAGATTTGCTGGTTGTTCTGGATTCAGAGGATGGGTTTAGATGTTGTACTTTTTTAGGAAAAAAGTATTTTATGAGAGGCATTCGTTTTACATAGATAGGAATGTGAAAAATGAGAAGCAAATTTGTTTTCCTACAGAATCATTGCCGTTTCGAGTTAGTCATGCAACAATGTGGATTAGCTGGGATATATATATATATTTATGTAACTTGTGGTGCGATTCGCTTTCAAGTCAATACTGATTACCTCAATTCATTTGAGTAAAATTTTTATGGATAATCAAAAAAAAAAAAA

 

2345

 

45702

 

Contig23019

sgn|E367507/sgn|E268022/sgn|E362658/LEFL1085BG09

1159

TC186290 similar to UP|Q9FHM9_ARATH (Q9FHM9) Gb|AAD25141.1 (AT5g51550/K17N15_10), partial (75%)

817

Show
Contig23019

Contig23019

 

sgn|E367507/sgn|E268022/sgn|E362658/LEFL1085BG09

 

1159

 

TC186290 similar to UP|Q9FHM9_ARATH (Q9FHM9) Gb|AAD25141.1 (AT5g51550/K17N15_10), partial (75%)

 

817

 

1546

 

0

 

816

 

98

 

1159

 

AK105690|Os06g0133600 Phosphate-induced protein 1 conserved region family protein.

 

348

 

409

 

1.00E-114

 

343

 

59

 

1159

 

gb|AAL24269.1| AT5g51550/K17N15_10 [Arabidopsis thaliana]

 

337

 

486

 

1.00E-136

 

333

 

71

 

1159

 

SGN-U329041

 

884

 

1592

 

0

 

884

 

97

 

1159

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

1159

 

AT5G51550.1 | Symbol: None | phosphate-responsive 1 family protein, similar to phi-1 (phosphate-induced gene) (Nicotiana tabacum) GI:3759184: contains Pfam profile PF04674: Phosphate-induced protein 1 conserved region | chr5:20956720-20958121 REVERSE | Aliases: K17N15.10, K17N15_10

 

337

 

486

 

1.00E-137

 

333

 

71

 

GAGAACTAGTCTCGAGTAATTAGTGTTTTTTTTTTTTAGAAAATAAAGTTATTTATAATACTAAAAAAATTGGAAATGAAAAATTTACTGATCAAGTGCATTAGGCCCAGTACAATAATTCACAACATGATTCCACACCCACTGAACCAAAAACTTTCTTCTTATTCCATTCATATTGTACGTTGCACCATCTTCACCGTTCAACATTTGCCCAGTATACGACCCACCACCACCCGACCCATATATCCCTTCACAAAGATCCCCTATCTCCACCGGAAAACTTGGATCGTCACCTGCATACCAAGCATTCACCAACGGATTCGTTGATAACTCAGCAATTTCATGAGCAATCACACTAATCATTCCGTCAACACCCACATCGTTATTCGGCGATTTCACAGCTTTGAAACCCCGACCCATGTAATCGGGTACGGAAAACGGGTATGCACAAACACTGGGGCATAGTTTGCCGGAGTTACCTACCCATGCGTATGGTAAGGTGTAACCCACAATGGAAGGGAAAGTGAAATAGTGAAATCCACAAACGTCTTGACAGAAATTTTCGACATAAACATCATCACATGTGAGTAGTAAATACACACCGCTTTTGGAATTTATCGGTAAAGGGGGAGTGGTACTGGCTGTGACGGCAGATTTTATAACAGACTGAATCGATAAACGGGTTAACGATTTGCCATGAGAGTAAGACCGATCGGTTTTTTCAGCTCCGATGTGTACATTACCGGAGATGTTGGCTCCGGTTTGGTCGGTGTAACTCTGGACTGTTTTCCACCAACCGGAAACTGACGGCGGTTTGGAATCGACGGCGGAGATTGAGTTGATGAACTCCCGGATAATTCTTTTCTGGGATTTGCTCCATCGGCCGTACCAAATGGGGTAAACGGTGATGTTGGCAGTGAGAACAGGGCCCATGTGGTATTTTAACTTAATTAAGTCCGATGAGCCTTCATACTTTTTGGATGGGCTGTACAATAAATCGGTGGTGTTGGGCTTTTGGTTGGGCCATGGACGCCACCCATTAACTGGGGAAGTTAATAAGAGTAGACAAATTCCGGCGAGAAGATAGAAAGTCGCCGGGAAATATGTTCGGTGACACTGGTCCATGTTCATGTGTAGTCGTAGTTGGTGTTGTGACTGT

 

1159

 

45703

 

Contig23020

sgn|E367336/LA11BH08/sgn|E323465/LA21BC10/LEFL1007DD03/LEFL1027BG12/sgn|E290980/LEFL1054AG01/LEFL1049AA10/LEFL1048AE10/sgn|E305781/LEFL2040A07/sgn|E367093/sgn|E256415/sgn|E550969/sgn|E368814/sgn|E246551/sgn|E259645/sgn|E368813/FB18AC02/sgn|E330859/sgn|E331119/FB18CB06/sgn|E226718/sgn|E226334

1408

TC185977 weakly similar to UP|Q9LQM1_ARATH (Q9LQM1) F5D14.14 protein, partial (8%)

1298

Show
Contig23020

Contig23020

 

sgn|E367336/LA11BH08/sgn|E323465/LA21BC10/LEFL1007DD03/LEFL1027BG12/sgn|E290980/LEFL1054AG01/LEFL1049AA10/LEFL1048AE10/sgn|E305781/LEFL2040A07/sgn|E367093/sgn|E256415/sgn|E550969/sgn|E368814/sgn|E246551/sgn|E259645/sgn|E368813/FB18AC02/sgn|E330859/sgn|E331119/FB18CB06/sgn|E226718/sgn|E226334

 

1408

 

TC185977 weakly similar to UP|Q9LQM1_ARATH (Q9LQM1) F5D14.14 protein, partial (8%)

 

1298

 

2264

 

0

 

1150

 

99

 

1408

 

AK064834|

 

367

 

85

 

1.00E-16

 

329

 

23

 

1408

 

gb|ABE93056.1| HPr serine phosphorylation site [Medicago truncatula]

 

360

 

180

 

1.00E-43

 

390

 

35

 

1408

 

SGN-U317709

 

1495

 

2783

 

0

 

1408

 

99

 

1408

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

1408

 

AT3G57990.1 | Symbol: None | expressed protein | chr3:21480979-21482463 REVERSE | Aliases: T10K17.200

 

367

 

96

 

5.00E-20

 

262

 

29

 

TTTTCTCCAGAGCTTCTCTGCTTCACAATCTTGGTAAGGCAAGTATCCCCATAAACGTTAAGCTTCCATTTTACATTCAAAGAGAAAAACGATGAAGCTCTCACTGAAACTCCAAGAGAATTCTCAAACCCAGAATCACCAAAAACAATCACAAACACACCCACTTCTCCTCCGTGCCAAAATCCCCATTTCCATTTTCAATCTTCCTTTCCTTTCTTGCTTCTCTACCACCACCCATCACCCTTCTGATCTCTCCCTTTCTCTTGCCACCAGTTTCCCTTCTGGACCTACTCTTAAACTCGCTTACTCCACTGCCTCAACTCCCATCACTCCCAGCTCCACCACCCCAATCGCCCCTCCTTTAACTCTGACGCTCAAATCTGGAATTGGGGTTTTTGGGTCTCCCAAGAACTCACCTTTAGTCATTTCTGCTAACTTTACCTTCTCCCCTTTGAATTCTAATCAAAATCCCACTTTTACCCTTCTCTTCAAACCCCAATTGGGTTCCTTTTCGCTTCGTAAAACCACTACTTCTGACCTGAATTCTAGTTCTACTGCCGTGGGTAAGCAGAATGGTGATGGAAATTCATTTGGGTTTGTTCCTTTGGAGAGGCCATCGAGTTTTAAGGAATTCTCGATGGAGGATTATGCGAAAGATTCTGTCTTTAAGGGGATTGCTGTAATGGCGAAGACGGAAATGCCTTTGACTAATAAGGTTGTGATGGATTGTCGTTGGGGTGTGAATTTTCCAAAGGATTTGGGAAGCAGGATGCCGTTTTTAAGTGTGAATAAGATCGGGATTAAGAGAATTGAGGAAGTTAAGGAGGTGAAGGAGAAGAAGGATAAGAATTCACGCGAAACAGAGTTGCTGAAAGGTATGTGCTTTTGGATGAAAAACGAGTTGGAGATGCTGCAGAGAGAGAATAGAGAGATGAAACATAGGTTGGAGGAAATGAAGATGGGGAATGGTGGTAGGAAGGGTGTTGGTGAGGCAGAGTTTGTAGGTGTGCAGGTGATTGAGAATTCAGGAGGATTTGAGCAGTGGAGGAATAAGAGGAATAGTGGGGGAGAGAATCCGAAGAAAGAGGTGAAGAAGAACTCCTCCAACGGGAATCGAGCAAGTGATGTTGAGAGTGAGTTGCAGAAAGCTATTAGGGCTGCTTCTTCATCATGAGGTTTGAACTGTCTACTAATTACCTCGAGTAAATAGTCAAATAATACTTCCTTTCTTAGTATGCAATGTATATATGAATGAGCTTGCTGTAACGTAAGTGTGATACTTATCTCCTTAAGGAGGGTTAGATTGATGAAGAATTTGAAGTTTTACTTCTCCAGACTATAGAGAAGGCTTCAGGTCCTCCCTCGCGAGCATTCTAATGTTAGTTTATCTTTATTCCTTTATCTAACT

 

1408

 

45704

 

Contig23021

sgn|E367403/LEFL1058DF08

705

AW399434

462

Show
Contig23021

Contig23021

 

sgn|E367403/LEFL1058DF08

 

705

 

AW399434

 

462

 

829

 

0

 

462

 

97

 

705

 

AK107497|Os06g0364500 Conserved hypothetical protein.

 

327

 

226

 

2.00E-59

 

187

 

55

 

705

 

ref|NP_563896.1| unknown protein [Arabidopsis thaliana]

 

329

 

290

 

4.00E-77

 

199

 

65

 

705

 

SGN-U343819

 

1049

 

1279

 

0

 

705

 

97

 

705

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

705

 

AT1G11915.1 | Symbol: None | expressed protein | chr1:4021823-4023290 FORWARD | Aliases: None

 

329

 

290

 

6.00E-79

 

199

 

65

 

AAAAGTGAAAGGTATTATAAAGCAAATTCCAACAGCAAAGATTCTCCATAAACACTTTCCCAATGCTACAGTTTTCCTTAACTATACAAAATCTTGGTAGAGAAAATCTTCAAGCAAATCTCACATGGCCATTTCAAATTTGTCCATCTTTATTATTTTCCTTGTACTTCAATTTCTATGCATAACAGAAGCTCAATCAAGCATTTGTAGAAATTCTTGTGGCGATATCCCAATTCAGTATCCTTTTGGCATTGATGATGGCTGTGGAAGTCCATTTTATCGACACATTCTTGTATGCACTGGTGGTCAGCTTCAACTCAGAACCCCTTCTGGTAGATATCCTGTTAGAAATTTGAGTTATATGGATCCACATATTCTTGTGACCGATCCCTTAATGTGGAATTGTCTAGATGGTGACAATTTTCGACCTACCAGGCCGTTTAGCCTAGATACTAGCACACATTTCACTTTGTCCTCTGAAAATGACTACTTGTTCTTTAATTGTAGTGAAAGTGATGTGTTAGTTGAGCCAAAACCAATGTTCTGCGAGCGTTTCCCTGATCAGTGTGATTCAACTTGTGATAGTTCGAGTTATCTTTGTAGGCACATGCCTGAATGTCCTACTGCTTTGAGGAGTAGCTCTTGTTGTTCTTACTATCCCAAAGCTACTGAATCTTTGAGGCTGATGTTGAAGCATTGTGCAAG

 

705

 

45705