KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Contig22992

sgn|E366987/sgn|E366485

561

TC177518 similar to UP|Q7XEG8_ORYSA (Q7XEG8) Expressed protein, partial (24%)

1199

Show
Contig22992

Contig22992

 

sgn|E366987/sgn|E366485

 

561

 

TC177518 similar to UP|Q7XEG8_ORYSA (Q7XEG8) Expressed protein, partial (24%)

 

1199

 

979

 

0

 

563

 

97

 

561

 

AK103624|Os10g0423000 Conserved hypothetical protein.

 

191

 

55

 

4.00E-08

 

72

 

43

 

561

 

ref|NP_680565.1| unknown protein [Arabidopsis thaliana]

 

205

 

61

 

3.00E-08

 

65

 

44

 

561

 

SGN-U335068

 

986

 

688

 

0

 

400

 

96

 

561

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

561

 

AT4G02715.1 | Symbol: None | expressed protein | chr4:1202170-1202787 REVERSE | Aliases: None

 

205

 

61

 

5.00E-10

 

65

 

44

 

TGGAGTTGTGATAAACGAAGAGCAGCACAAGCTCCCAATACCAAATTTAGTACTACTGACCAATTATAAAGAGTAAATATAGAAGATTAGGGTTTTAAGATCTCTAACAAAATTGCACTGGGAAGAAATCTGGTTCTTCAATTTTCTGGGATTTATCAGATCTGAAGAAACTGAAGAGTGAAGTGGTAATCGTTGATAAGTGTATGTTCAAGGGAGGATTGTTTGGATTTACTGAACTGTTGTTGATGTGGTTTTGGAGAAGATAAGATCTGTGATTTGTAAAACCCAAAACGGATTCTTTTTGTACTTGATTGATAGATCTTCAGTTTTTTTGGGAGTTGAATCAGTTATTGTTTAATTTAGAAATGGAGACACTTGTTGTTGTTTCTCAGCATAAGAATCACTACTATGATAGAACTAGGGGTCAAGCTCCCATTCGATGTGGATCCTTTGGGTCACCTCCTTCTGTAGGGTTCAAAGAGATAAATTGCCGGAATTTTGAATCAAGTGCCGGTATACTTCCTACCCCGTTAAAGGCCTATTCCACACCAGTCACTAAAA

 

561

 

45676

 

Contig22993

sgn|E366874/sgn|E366764

596

TC174138

804

Show
Contig22993

Contig22993

 

sgn|E366874/sgn|E366764

 

596

 

TC174138

 

804

 

902

 

0

 

583

 

94

 

596

 

AK065996|Os04g0547900 MutT domain protein-like.

 

368

 

65

 

4.00E-11

 

150

 

30

 

596

 

emb|CAE02019.1| OSJNBa0079A21.21 [Oryza sativa (japonica cultivar-group)]

 

389

 

65

 

3.00E-09

 

150

 

30

 

596

 

SGN-U321856

 

595

 

1080

 

0

 

596

 

97

 

596

 

Q8L7W2|NUDT8_ARATH Nudix hydrolase 8 (EC 3.6.1.-) (AtNUDT8) - Arabidopsis thaliana (Mouse-ear cress)

 

369

 

59

 

2.00E-08

 

66

 

46

 

596

 

AT5G47240.1 | Symbol: ATNUDT8 | MutT/nudix family protein, similar to SP:P53370 Nucleoside diphosphate-linked moiety X motif 6 {Homo sapiens}: contains Pfam profile PF00293: NUDIX domain | chr5:19200944-19202871 FORWARD | Aliases: MQL5.10, MQL5_10, ATNUDT8

 

369

 

59

 

3.00E-09

 

66

 

46

 

AATACCAAACAAATTTTCTTGTTTTAAGCATTGTGAAGGAATCTTATATTATTTTTCTTGGAAAAAATTCTATTTTTTTTTCTTCTTCTTATCTTAGTTTATTTATAAAAGTCAAGGTTTTGATATTTCATTTGGACTGTATGATGGAGCTGAAATTAATTGATGTTAAGTCAATGTCCATGTGTAAATCAGTTGGTATTGAGGGGTTTATGAAGTTTTCTAGCTCATTTCTTGATTCAAACCTCATGTTTGGTGTTAATGTGGCTCCAAATTTCTGTTCTTACAGAGGGCTGTTAACAAAGGCTTCTTATTCAAGCACTTCTTATGATGCTTCAAGATCAGTAAGCAAGAAGGATTTATTAGAGGACACTTTCTCTTATAAGATAAACGGTACAAACCATACGAGTTTGTATTTTCGAGATAATTGGTTGCTTGATGCTTCTGACGATGAATATGGAGGAGTACTCGTCAATGCAGATAGGCTACCATCTGATCGCGACAAATTCACCTTTGTTCTTCGTGCATCTCTCTCTCATTGGAAAAGTGAAGGGGAAGAAGGGAGTTTGGCTTAAGCTACCACTAGAAAAATGTGATCT

 

596

 

45677

 

Contig22994

sgn|E366986/sgn|E249879

820

TC188533 similar to UP|Q6ZHB2_ORYSA (Q6ZHB2) S-ribonuclease binding protein SBP1-like, partial (8%)

795

Show
Contig22994

Contig22994

 

sgn|E366986/sgn|E249879

 

820

 

TC188533 similar to UP|Q6ZHB2_ORYSA (Q6ZHB2) S-ribonuclease binding protein SBP1-like, partial (8%)

 

795

 

1511

 

0

 

797

 

99

 

820

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

820

 

ref|NP_193503.2| unknown protein [Arabidopsis thaliana]

 

314

 

44

 

5.00E-07

 

137

 

31

 

820

 

SGN-U315585

 

820

 

1626

 

0

 

820

 

100

 

820

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

820

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TTAATTAGGCCTTCCCTTCCTCACCACTCTCTTTTACCAATCAAAATCCCTTCCTTCTATATATATACACACACACCCAGCTTTCTTGTGTTTGATCATTCTTCAATGGCTGTTCAAGCTCAATATCCATCTAATGTTCACCTCTTTAACAGGTGGTAAACTTCTCAAATTTATCTTCTTTCTTTTTGTCATTACTAGTAACTTACTTAATGAAGGTAATGTTCATTGACTAACAGAGCTGTGCAAGAACGAAAGAACCCAATTGGCAACGATGAATATTCGTTGCAACCTCAACCTGCTGGAGGATCAATTCTTGATCACACACAAATGCGATTCAATCCAGGAGCTGGCTCTTCTCATCATCCGCCGTGTAAGAGAAGAAGAGAAGTTAGCACCACCACTGCAATGAATCCGTCAATGCAATCTCAGCCGCAGCTGATTGATCTCACTCAGCTTCATACAAATCCAAATGTTGTCTCCACCGGCCTCCGTTTAGCTTCTGGAGAACAGGTACAACACCATCAAAAGCAGCAACAACAAAACCAACACTCTCTTTCTCCTCAATCTTCTGCAATCATCAGCTTTCTATTCCATATTCACAGAAGACATGTCTACTATTATCAAACAACACCGCGATGAAATTGAACAATTCCTCCATGTTCAGGTATAGCGAATTTTAGGGCTTTTTAATTTGTTAGACTGTATTGCAATGGATAATAGTTTTGTTTGGTATTAACAGAGAGAACAATTAAGACGGACATTAGAGGATAAAAGGCGAGCACACTATCGTGCTCTGATTGGAACCGCCGAGGAATCAATG

 

820

 

45678

 

Contig22995

sgn|E366898/sgn|E546986

881

AW398338 similar to GP|13249119|gb|AAK16685.1 CBL-interacting protein kinase 10 {Arabidopsis thaliana}, partial (25%)

485

Show
Contig22995

Contig22995

 

sgn|E366898/sgn|E546986

 

881

 

AW398338 similar to GP|13249119|gb|AAK16685.1 CBL-interacting protein kinase 10 {Arabidopsis thaliana}, partial (25%)

 

485

 

952

 

0

 

484

 

99

 

881

 

AK101355|Os05g0332300 Novel serine/threonine protein kinase (CBL-interacting protein kinase 15) (SOS2-like protein kinase PKS3).

 

457

 

229

 

1.00E-60

 

264

 

46

 

881

 

gb|ABJ91221.1| CBL-interacting protein kinase 14 [Populus trichocarpa]

 

438

 

263

 

8.00E-69

 

250

 

56

 

881

 

SGN-U324146

 

1498

 

1746

 

0

 

881

 

100

 

881

 

P92937|CPK15_ARATH CBL-interacting serine/threonine-protein kinase 15 (EC 2.7.11.1) (Serine/threonine-protein kinase ATPK10) (SOS2-like protein kinase PKS3) (SOS-interacting protein 2) (SNF1-related kinase 3.1) - Arabidopsis thaliana (Mouse-ear cress)

 

421

 

189

 

1.00E-47

 

242

 

42

 

881

 

AT5G58380.1 | Symbol: None | CBL-interacting protein kinase 10 (CIPK10), identical to CBL-interacting protein kinase 10 (Arabidopsis thaliana) gi:13249119:gb:AAK16685: contains Pfam profiles PF00069: Protein kinase domain and PF03822: NAF domain: identical to cDNA CBL-interacting protein kinase 10 (CIPK10) GI:13249118 | chr5:23614188-23616468 REVERSE | Aliases: MCK7.25, MCK7_25

 

479

 

236

 

1.00E-62

 

279

 

47

 

CTATGATGGGACTAAGGCTGATATCTGGTCGTGTGGGGTTGTCCTATACGTTTTGTTGGCTGGTTATCTTCCATTTCAAGACTCAAATTTGATGGAGATGTATAGGAAGATTGGGAAAGCTGATTACAAATGTCCGAGTTGGTTTCCACCAGAAGCCCGACGTCTACTTTCAAGAATGTTGGATCCTAATCCAAGTTCAAGAATTTCCCTTGCAAAAATTAGAGCAAGTTCGTGGTTCCGGAGGGGAATTTCAACTTCCTCTAAATCTACAGTAGTAGACGACGTAAGCACGGATTTAGCTTCAGCAAATAAAGAGGACAAGCAAGAAGTGGCTTCGATTCCAAAGTTGAATGCATTTGATATCATTACCCTTTATGCTAAATTTGATTTATCCAGATTGTTCGAGGAACCTTGTTTAAAGAAAGAAACTAAATTCACATCCCGGAAAACTGCATCAGTGATCATATCCAAGCTCGAAAATATTGCTAAACATCTGAAGCTGAAAGTTTGCAAAAGGGATGCAGGACTACTGAAGTTCGAAGGAACAAAAGAAGGAAAAAAGGGAACTTTGAGCATTGACGTGGAGATCTTTGAGGTCGTTGAAGCTTTTCATTTGGTGGAAGTTAAAAAATCAAACGGGGATACATTGGAATATCAACAGATATTGAACGAATGCCTCAGACCGGGTCTTCAAGATATCGTTTGGACTTGGCAAGAAGATCAACAGCTGCCTCAGCAGTCGGAAGACCAGCTTCACGAGCAGACACCAAATAATCAACTTCAGCAGGAACAACATTTAGATAACCAGCAACAACCTCCAGAGCAGCAGCAACTGCTACTCCAAAACCATCTGATACAGCAAGAGCAGTTACCTTGATTAC

 

881

 

45679

 

Contig22996

sgn|E366757/LB11CE10

499

BP904459

467

Show
Contig22996

Contig22996

 

sgn|E366757/LB11CE10

 

499

 

BP904459

 

467

 

922

 

0

 

465

 

100

 

499

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

499

 

gb|ABB86250.1| RNA-binding protein AKIP1-like [Solanum tuberosum]

 

498

 

58

 

2.00E-14

 

32

 

68

 

499

 

SGN-U313574

 

540

 

934

 

0

 

475

 

99

 

499

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

499

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TTTTTTTTTTTTTTTTTTTTAAGGGCAAAATCCTACATAGTGTTTAAAAACATTCACTAGAATAAAAGTACTTGAATAAAAAAGAAAATACACATTGAAGATTATGGTCTTTAAACAAAAGATAACTTTTGACATAGTAAAAGACTTCATTTGGAGAGTGCCCGGAACTTCAGAAGAATCACCAGTCCAAAACTAAAAGTTTGATGCATTTATGAAGGAATCTCACTTAGGAGTAGAGCCATAGCATTATAGATACCTTAAGTTTTCCTAGTGACCTCCATAGCCAGAGTATGGTGCACCACCACCTTGTGGTCTTGCACCACCCTGCATCTGTTCACCACTGGTTGCACACCCTGATGACTCACTGGCCCACCAAGACCTCCAAGCAAATTACCGATCCCCAAACCAGCTCCTTGTGTAGCTAACAGCGCTGTCAGTGCCTGTCCAAGAGCTGGGGTCACAGCTGCAACGGCAGGATTGTATCCCACCCTGGGCACCA

 

499

 

45680

 

Contig22997

LA10AG11/sgn|E292333/sgn|E366946/sgn|E214460/sgn|E330525/sgn|E249622/sgn|E281002/sgn|E286582/LEFL1018DC01/LC14DG11/LA04AC10/LA15DA12/sgn|E297310/sgn|E291443/LA21CC03/LC01AA03/LC22AB09/sgn|E266648/LC10BA03/LA26CH08/LEFL1010BB04/sgn|E214869/sgn|E330337/sgn|E366618/sgn|E343300/sgn|E317752/LEFL1098BD04/LEFL2029K02/LEFL1025DB11/LEFL2039M17/sgn|E365245/LEFL1025AG10/LEFL1091BG10/sgn|E317797/LA19BF09/sgn|E213626/sgn|E345906/sgn|E207592/sgn|E346715/sgn|E340328/LA12DA01/sgn|E332062/LA03DD03/FA57BF02/sgn|E296839/sgn|E296838/sgn|E289839/sgn|E294823/sgn|E272787/sgn|E284122/LB13CH08/LB01CD09/sgn|E285807/sgn|E218323/sgn|E217823/sgn|E224595/LB01CE10/LC14AF08/sgn|E215580/sgn|E215900/sgn|E224671/sgn|E281097

1878

TC183085 similar to UP|Q45RS3_VITVI (Q45RS3) AlaT1, complete

1972

Show
Contig22997

Contig22997

 

LA10AG11/sgn|E292333/sgn|E366946/sgn|E214460/sgn|E330525/sgn|E249622/sgn|E281002/sgn|E286582/LEFL1018DC01/LC14DG11/LA04AC10/LA15DA12/sgn|E297310/sgn|E291443/LA21CC03/LC01AA03/LC22AB09/sgn|E266648/LC10BA03/LA26CH08/LEFL1010BB04/sgn|E214869/sgn|E330337/sgn|E366618/sgn|E343300/sgn|E317752/LEFL1098BD04/LEFL2029K02/LEFL1025DB11/LEFL2039M17/sgn|E365245/LEFL1025AG10/LEFL1091BG10/sgn|E317797/LA19BF09/sgn|E213626/sgn|E345906/sgn|E207592/sgn|E346715/sgn|E340328/LA12DA01/sgn|E332062/LA03DD03/FA57BF02/sgn|E296839/sgn|E296838/sgn|E289839/sgn|E294823/sgn|E272787/sgn|E284122/LB13CH08/LB01CD09/sgn|E285807/sgn|E218323/sgn|E217823/sgn|E224595/LB01CE10/LC14AF08/sgn|E215580/sgn|E215900/sgn|E224671/sgn|E281097

 

1878

 

TC183085 similar to UP|Q45RS3_VITVI (Q45RS3) AlaT1, complete

 

1972

 

3596

 

0

 

1818

 

99

 

1878

 

AY236227|Os07g0108300 Alanine aminotransferase.

 

485

 

834

 

0

 

478

 

85

 

1878

 

gb|AAZ43369.1| AlaT1 [Vitis vinifera]

 

484

 

874

 

0

 

481

 

88

 

1878

 

SGN-U313936

 

1878

 

3604

 

0

 

1818

 

100

 

1878

 

P34106|ALA2_PANMI Alanine aminotransferase 2 (EC 2.6.1.2) (GPT) (Glutamic--pyruvic transaminase 2) (Glutamic--alanine transaminase 2) (ALAAT-2) - Panicum miliaceum (Proso millet) (Broomcorn millet)

 

482

 

497

 

1.00E-140

 

476

 

52

 

1878

 

AT1G70580.4 | Symbol: None | similar to glutamate:glyoxylate aminotransferase 1 (GGT1) [Arabidopsis thaliana] (TAIR:At1g23310.1): similar to alanine aminotransferase [Oryza sativa (indica cultivar-group)] (GB:AAO84040.1): contains InterPro domain Aminotransferase, class I and II (InterPro:IPR004839): contains InterPro domain 1-aminocyclopropane-1-carboxylate synthase (InterPro:IPR001176) | chr1:26616525-26619732 FORWARD | Aliases: None

 

481

 

858

 

0

 

481

 

86

 

TGGTTTCATCTTGGAATTTATGTCTTCACACTTGGCCACATATACAAATAATAATATACTATAATTATCCCCTTTTCCTTTACACCCCAATAAAAAATAAATTGAACTTCTCACTCACCATTCACCAAACTGACTCACAACACTTGCCTCCTAACTGTGTTTTGAGCCGAGGTGCTACATTGCCAGTACGGGCATCACTTTGCTTGGAATTTTAACTAAGAGGAAAATTTTAATTCCTTATAATGTCTTCTAAGGCATTAGACTATGAGAATCTGAACGAAAATGTCAAGAAGTGCCAATATGCTGTCAGAGGTGAGCTGTACCTTCGAGCTTCTGAGCTTCAGAAGGAAGGCAAAAAGATCATCTTCACCAATGTTGGTAACCCCCATGCCCTTGGGCAGAAACCACTGACATTTCCACGCCAGGTCATTGCTCTCTGTCAAGCTCCATTTTTACTGGATGATCCGAATGTGGGACTCATATTCCCTGCTGATGCAATTGCAAGAGCCAAACAGTTTCTTGGGATGACTTCTGGAGGTCTAGGTGCTTATAGTGACTCCCGAGGCATTCCTGGTGTAAGGAAAGAAGTTGCAGAATTCATTGAGAGACGTGATGGATATCCAAGTGATCCAGAACTCATATTTCTCACAGATGGTGCCAGCAAAGGAGTGATGCAGATCTTGAACAGTATCATTCGCGGCCCAAGTGATGGGATATTGGTACCTGTTCCCCAGTATCCACTATACTCAGCTTCAATACAATTATTGGGGGGTTCTCTTGTTCCTTACTACCTTGAAGAGACTGCAAACTGGGGTCTTGATATCAATGACCTTCGCCAATCAGTTGCACAGGCACGATACAAGGGAATAACTGTACGAGCTATGGTGATTATAAACCCTGGAAATCCCACTGGACAATGTCTTAGTGTGGCAAATCTTAAGCAAATTATTCAATTCTGTCACCAAGAAAATTTAGTATTACTTGGAGACGAAGTTTATCAGCAAAACATTTACCAAGATGAGCGCCCCTTCATAAGTGCAAGAAAGGTTTTATTGGATATGGGACTACCATTAAGCAAGGAGGTTCAGCTTGTCTCGTTTCACACTGTCTCCAAAGGATATTGGGGTGAATGTGGACAGCGTGGAGGATACTTTGAGATGACCAACATTCCTCCCAAGGCTGTTGAAGAAATATACAAGGTTGCTTCAATTTCACTCAGTCCAAATGTACCTGGACAGATATTTATGGGGCTCATGGTGAACCCCCCTAAACCTGGAGATATCTCATATGACCAATATGTCAGAGAGAGTAAGGGTATCCTCGAGTCATTAAGGAAGAGGGCACACATGATGACTGATGGTTTCAACAGCTGCAGAAATGTTGTTTGTAATTTCACAGAAGGTGCAATGTATTCCTTCCCGCAAATACGATTGCCTCCTAAAGCAATAGAGACTGCAAATAAGCTTGGGAAAGCTCCTGATGTTCTCTATTGTCTGAGGCTGTTGGAAGCAACTGGCATCTCCACCGTCCCTGGTTCAGGTTTCGGTCAAAAGGAAGGGGTGTTCCATCTAAGGACAACCATCTTGCCAGCTGAAGAAGACATGCCAGCAATAATGGAAAGTTTCAAAAAGTTCAATGATGAATTCATGGAGAAATATGAAGACCACAAAGGTTATTCCAGGATGTAATAGAAAAAAGATGGTTGGAGCATTTATTGTATATGTTTTTACCTTGCAACTACTGCAACTTTTTTCACAAACAAATTATTGTACACTACTTGATCTCTTCTCCCCTCTTTTTAACTTTCATTTATGTGTTTATATATATATATATATATATATATGACTTGCTAGAAAAAAAAAAAAAAAAAAAACTCGA

 

1878

 

45681

 

Contig22998

sgn|E366990/FA34AE10/sgn|E312748/sgn|E204893/sgn|E202395/sgn|E260979/FA53AH04/sgn|E351993/sgn|E218521/LB14BA03

2064

TC187018 similar to UP|Q6H975_ANTMA (Q6H975) STY-L protein, partial (52%)

1549

Show
Contig22998

Contig22998

 

sgn|E366990/FA34AE10/sgn|E312748/sgn|E204893/sgn|E202395/sgn|E260979/FA53AH04/sgn|E351993/sgn|E218521/LB14BA03

 

2064

 

TC187018 similar to UP|Q6H975_ANTMA (Q6H975) STY-L protein, partial (52%)

 

1549

 

3001

 

0

 

1518

 

99

 

2064

 

AK103520|Os02g0813800 Lissencephaly type-1-like homology motif domain containing protein.

 

802

 

622

 

1.00E-178

 

629

 

53

 

2064

 

emb|CAF18246.1| STY-L protein [Antirrhinum majus]

 

777

 

900

 

0

 

599

 

75

 

2064

 

SGN-U317401

 

2445

 

3281

 

0

 

1796

 

98

 

2064

 

Q9FUY2|LEUNG_ARATH Transcriptional corepressor LEUNIG - Arabidopsis thaliana (Mouse-ear cress)

 

931

 

452

 

1.00E-126

 

420

 

56

 

2064

 

AT2G32700.2 | Symbol: None | WD-40 repeat family protein, contains 7 WD-40 repeats : similar to LEUNIG (GP:11141605)(Arabidopsis thaliana) | chr2:13873888-13879217 FORWARD | Aliases: None

 

787

 

593

 

1.00E-169

 

616

 

53

 

TGAACTTGGGTGGCACTCACAAGTCTTTGCCCATGGATCCTTCATCAATTTATGGGCAAGCGGTTCTTCAGTCAAAGGCTGGTCTTGGTGCAGGGTTGAACCAAGGCGGCACTACTCTACCATTGAAGGGTTGGCCTTTAACAGTAAGTTACCTAGTACTTTTGGTCATCACTGCTTTTAGTATATTGAATTTTTGACGTGTATAGTCGATTGCTTTGCTCATATCATATGTTCAGGGAATTGATCAGGTAAGGCCTAGCTTGGGTTTGCAAGTACAAAAACCCAACTTACAGACCCAAAATCAATTTCTTTTGGCATCACAACAACAACAGGTCTTAGCTCAAGCTCAAGCCCAAGGTAACCTTGGAAACTCACCTAATTATGGGTTTGGTGGATTACCTAGAGGGAACTTCAACGCCAAAGATGGTCAGCCCCCTAGAAATGATGGATCCATTTGCTCTCCAGTACAATCAAATTCACCAAAGATGAAAATGGCCCAAATTCCACAATCCTCCTCTCAACAACAGGACCAGTTGCAGCAGCAACTGCCACAGAATGGAAGAAAAAGGAAGCAGCATTCGTCGTCTGGACCTGCCAATAGTACTGGCACCGGAAATACTGTTGGCCCTTCACCAAGCTCACCAGCATCAACTCATACACCTGGTGACGGGATGACTAGTGCCAGTAGTCTGCAGCATGTTGGCAGTGTGTCAAAAAGCATGATGATGTATGGAGGAGATGGAACTGGTGGTATAGCATCCTCTACAAATCAGCTGGATGACTTGGAGACGTTTGGAGACATTGTTTCCCTGGAAGATAACGTGGAGTCATTTTTATCAAATGATGGGGGAGATGGTAATATCTATGGAGCAATGAAACAAACGATTACTGAGCACAAACCTGAGTCTTCTAAAGGCGGGTTCTCCTTCGGTGAAGTTGGTTGTATACGCACAAGGAATAAAGTCACTTGCTGCCATTTCTCATCAGATGGAAAGCTGCTCGCTAGTGCCGGACATGACAAAAAGGCTGTTCTGTGGAACATGGATACCTTACAAACGGAGACCACCCCAGAAGAACATCAATTCTTGATTACAGATGTCCGGTTCAGGCCTAATTCGACTCAGCTTGCAACTGCTTCATTTGATAAGTCTGTGAGATTGTGGGATGCTGCCAATCCTGGCTACTGTTTGAATTCATACACCGGGCATTCTTCTCATGTTATGTCGCTGGATTTCCATCCGAAAAAGAATGATCTGTTCTGTTTCTGTGATAGCAACGATGAGATTCGGTACTGGACTATTAGTCCATTCTCATGTACTCGAGTGTCAAAGCAAGGAGGCAGTGCACAAGTGAGATTCCAGCCAATAACTGGTCAGCTGCTGGCAGCTGCATCAGATAAGGTGGTATCCATCTTTGATGTCGAAAATGACAGGCAACTGCAGTCTTTCCAGGGACATACTGGAGTGGTGAACTACCTTTGTTGGGATCTCAATGGTGATCTACTGGCATCAGTAAGTGAGGAGTCTGTCAAAGTTTGGTCACTGAACACTGGTGATTGCATCCACGAGCTAAGTTCAAACGGAAATCAGTTCCACTCTTGTGTATTTCACCCTAGTTATTCAGCTCTATTGGTGATTGGAGGAATGAGGTCTTTGGAGCTGTGGAACATGGTTGAGAATAAAAGCATGACAATTCCAGCACATGAAAACATTGTCGCCGCTCTAGCACAGTCACCAGTGAGTGGAATGGTTGCTTCTGCAAGTCATGACAGTTCTGTGAAGTTATGGAAATAAAACTAGGAGAGGATTTGATGCCGCGATATATATGCGCTTCAGGTGTTAGGGAAAAGTCCGTCTATGTTGTTTTAGTGTATTGTTGATCAGAAAATATCAATTTTTCTGCTTGTTAGTCATCACATTAGAGTTTGGTTTGCTTAAAGCAAGTTGAGCATACTGATTGCTGAGCAATGGTTCGGTAGTGTAATGTCTGCAACTGTTCTCAGTGATTAACAACTAATAATAACATGATATCAAGTTTAAGCTTATTTCGGCTGTAAAAAAAAAA

 

2064

 

45682

 

Contig22999

sgn|E366820/LEFL2052O20

978

AW399121

576

Show
Contig22999

Contig22999

 

sgn|E366820/LEFL2052O20

 

978

 

AW399121

 

576

 

1134

 

0

 

576

 

99

 

978

 

AK105807|Os01g0532200 FF domain containing protein.

 

467

 

61

 

2.00E-09

 

94

 

32

 

978

 

ref|NP_175113.2| protein binding [Arabidopsis thaliana]

 

958

 

144

 

6.00E-67

 

95

 

71

 

978

 

SGN-U344558

 

848

 

1411

 

0

 

764

 

98

 

978

 

Q9R1C7|PRP40_MOUSE Pre-mRNA-processing factor 40 homolog A (Formin-binding protein 3) (Formin-binding protein 11) (FBP-11) - Mus musculus (Mouse)

 

953

 

81

 

7.00E-15

 

95

 

44

 

978

 

AT1G44910.1 | Symbol: None | similar to FF domain-containing protein / WW domain-containing protein [Arabidopsis thaliana] (TAIR:At3g19670.1): similar to formin binding protein 3-like [Oryza sativa (japonica cultivar-group)] (GB:BAD87484.1): contains InterPro domain FF domain (InterPro:IPR002713): contains InterPro domain WW/Rsp5/WWP domain (InterPro:IPR001202) | chr1:16978044-16985405 FORWARD | Aliases: F27F5.2

 

958

 

144

 

8.00E-35

 

95

 

71

 

AATTCACAACTGCCGATGGTCGGAAGTATTACTACAACAAAGAAACCAAGCAGTCTAAGTGGACAATGCCTGATGAACTAAAGTTGGCTCGTGAACTCGCTGAAAATGTTGCTAGTCAAGTAGTTCAGACTGGAACAAGCACAAATTCTGGTGTGCAAGTCAGTGAAGCTGTGACCTCAACAGAACAACCATCTGCTGTCACCCCGGTTAGCTCCACATCTTCTTCAACGGTTTCTGGAGTTGCTTCAAGCCCTGTTCCAGTTACGCCTGCTGTTTCTGATGTTAATACTCCACCTTTGGTGGTTTCTGGATCATCAGCCATTCCTACTGTGAGCTTTGCTGTGACAAGTTCAGCCGGTATCTCTTCACCTGCTGTTTCAGGGAATACAAGATCTGCTGCTCTAGCTAATGCCTATCAGACACAAATGAGTGGCATTGAAAATTTATCTCCTCAAGTTGCTAGTTCTTTAAGTGGAGCTTCTAGTCAGGATATTGAGGAGGCAAAGAAAGGCATGGCAGTTGCTGGGAAGATCAATGTGGTACCTGCAGAAGAGAAATCAGCAGATGAAGAACCTTTTCTATATGCCACCAAGCAGGAGGCTAAACATGCATTCAAATCTCTATTAGAGTCTGCTACTGTTGAATCTGATTGGACATGGGAGCAGACAATGCGAGTTATAATCAATGATAACGGTATGGGGCTCTGAAAACTCTTGGTGAGCGGAAACAAGCATTTAATGAGTACTTGATGCAAAGGAAGAAACAGGAGGCTGAGGAGAGGCGCCTTAAACAAAGAAAGGCAAAAGAGGAATTCACAAAGATGTTAGAGGAGTCCAAGGAACTCACTTCATCTACAAGATGGAGTAAGGCAGTAACAATGTTTGAGGATGATGAACGGTTCAAGGGTGTTGAACGAGAGGCTGATCGTGAAGATCTTTTCAGGAACTACTTGGTGGATCTTCAGAAAAAGGAGAGGTC

 

978

 

45683

 

Contig23000

sgn|E367032/sgn|E549494

439

AW399267

359

Show
Contig23000

Contig23000

 

sgn|E367032/sgn|E549494

 

439

 

AW399267

 

359

 

712

 

0

 

359

 

100

 

439

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

439

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

439

 

SGN-U315067

 

439

 

829

 

0

 

418

 

100

 

439

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

439

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GAGTTTTTTTTTTTTTTTTTTGAAACTCAGAAAGGAAAAATTTAACCCCTCAGCTTTAAAGTGATAACAGTACAACGCCTAAGCTTTTGTTAAAATACAACGCCACCGATGTTTGCTACAGTTTTATTCTCTTCAAACCATGATTAAACCGACTAGCGGCACTTTTAAGATGCCACCTTGAAATAGAAAGTATTTTCAATGGCAGGGGGTGGGGTGGGGAACGTAGTTGGTCGCACATCACCCAACCTAAAACCAATTTAAGCTCCAGTAACTTCTGCTGTGCACCAATTATTGCCATCACAGACAGGAGAGAATTGGAAGTCGCATATATAGAAGAACAGAAGGTGCAAGTCTCGACATAACTGCATCTAATCACAAAATGTTCAAAGAAACTAAAGCTACATAACACCAAAAACAAAGAGAGATAGAGAGAAGAGGA

 

439

 

45684

 

Contig23001

sgn|E319252/LEFL1091AC07/LEFL2049F01/LEFL1058AC06/sgn|E366854/sgn|E302119/sgn|E366455/LEFL1061AE05/sgn|E542396/sgn|E542389

790

TC185396 weakly similar to RF|NP_680572.1|22328287|NM_148206 catalytic/ protein phosphatase type 2C {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (10%)

526

Show
Contig23001

Contig23001

 

sgn|E319252/LEFL1091AC07/LEFL2049F01/LEFL1058AC06/sgn|E366854/sgn|E302119/sgn|E366455/LEFL1061AE05/sgn|E542396/sgn|E542389

 

790

 

TC185396 weakly similar to RF|NP_680572.1|22328287|NM_148206 catalytic/ protein phosphatase type 2C {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (10%)

 

526

 

946

 

0

 

528

 

97

 

790

 

AK100141|Os08g0500300 Protein phosphatase 2C-like domain containing protein.

 

436

 

108

 

5.00E-24

 

105

 

48

 

790

 

gb|ABE77622.1| Protein phosphatase 2C-like [Medicago truncatula]

 

470

 

176

 

1.00E-42

 

140

 

60

 

790

 

SGN-U324104

 

790

 

1507

 

0

 

790

 

98

 

790

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

790

 

AT4G03415.1 | Symbol: None | protein phosphatase 2C family protein / PP2C family protein, similar to protein phosphatase-2C: PP2C (GI:3643088) (Mesembryanthemum crystallinum): contains Pfam PF00481 : Protein phosphatase 2C domain: | chr4:1503788-1505508 REVERSE | Aliases: None

 

453

 

171

 

4.00E-43

 

137

 

62

 

AGAGAACTAGTCTCTTCATTATTTCCTTTTTTATGCTTTTGTAATTAATTAATGCCAACTTCTATCTATTCCCATACTTCTCACTCTCTTCCCTTCTTCTCCTTTTTCTCTTCTATTCAACAACAAAAAGAAGACATAAATCACATTCTTGATCCCAGCTATCACTAAGCCAACCTGAAGGGTGCAATATTTTGACCAAGATTAAAAAGAATCGCGTTGGATGCTTGTGAGTTCTACAGTTTTTTTTTTGCTTAGTTCACAATTCAGTCTGATCCAGTTTCATTGGGAGGAAGAACATTTCTTTTGTTGTGGATCAGATGGTCTCTTTGTGTTTCTGAGAAAATGGGGGGTTGTGCTTCTACCAGCAATCATAGTACTTGTAGTAGCAGGAGCAACGGAGAACGAGTTTCCCCTGAATGTTTGGGGATAAGTATGTTTAGTCGAAAGAGGATTAGAAAAACTTTTTCTGATCCTGTCACTACATTGCAACATCTGACTTCAATACCTAATCGGATATTCAAAAATGGGAAGAGCAGGACTTCTTGCATATTCACTCAACAGGGTCGTAAAGGCATAAACCAGGATGCCATGGTTGTCTGGGAAGATTTCATGGCTGAAGATGTGACCTTTTGTGGGGTATTTGATGGTCATGGTCCACATGGCCATCTTGTCGCACGCAAAGTAAGGGATGCACTGCCCTTGAAGCTAGCGTCGTTTTTGCAATCATTTGACTCAAAGCACAATGGTTCTACTGCAAATTGCTGCAGTGGTGATAAAAATTGGATGTGGT

 

790

 

45685

 

Contig23002

sgn|E367033/FA06BB06/sgn|E296380/sgn|E548496/sgn|E541112

1164

BP876887

480

Show
Contig23002

Contig23002

 

sgn|E367033/FA06BB06/sgn|E296380/sgn|E548496/sgn|E541112

 

1164

 

BP876887

 

480

 

944

 

0

 

480

 

99

 

1164

 

AK064758|Os04g0407900 Cytochrome P450 77A2 (EC 1.14.-.-) (CYPLXXVIIA2) (P-450EG5).

 

467

 

319

 

3.00E-87

 

338

 

48

 

1164

 

sp|P37123|C77A1_SOLME Cytochrome P450 77A1 (CYPLXXVIIA1) (P-450EG6)

 

499

 

544

 

1.00E-153

 

331

 

81

 

1164

 

SGN-U323850

 

1159

 

2248

 

0

 

1138

 

99

 

1164

 

P37123|C77A1_SOLME Cytochrome P450 77A1 (EC 1.14.-.-) (CYPLXXVIIA1) (P-450EG6) (Fragment) - Solanum melongena (Eggplant) (Aubergine)

 

499

 

544

 

1.00E-154

 

331

 

81

 

1164

 

AT3G10570.1 | Symbol: None | cytochrome P450, putative, similar to cytochrome P450 77A3 GB:O48928 (Glycine max) | chr3:3302109-3303844 FORWARD | Aliases: F13M14.15

 

513

 

404

 

1.00E-113

 

331

 

59

 

AAATGATGAAAGATGTGTTGATTGTGCTTGATCCAAGGATTGATGATTTTCTACCTATTTTGAGATTATTTGTTGGTTATAAGCAACGTAAAAGAGTTAACGATGTTCGTAAAAGGCAAATCGAGACCCTCGTTCCACTTATCGAGAAACGTCGTAGGGTTTTACAAAATCCTGGGTCCGACAAGACCGCAACCTCGTTTTCCTACCTAGACACCTTGTTCGACGTTAAAATTGAAGGTGTAGTCTCATCTGAGCTAACTTTTAAAGTTGAGTGGTATCAGAGCCAAACTCACTTTATTAAAATTCATTTCTCAATATAACTACTTAATTATTTTTTCTTGATAGGTAGAAAGTCAGGACCGACGAATGCAGAGCTTGTGACGCTATGCTCAGAGTTTTTGAACGGTGGGACCGACACGACAGCTACGGCATTAGAGTGGGCCATAGGGAGATTGATTGAGAATCCAAGCATACAAGAGAAAATATACAAAGAGATCAAAACCGTAGTAGGTGATAAAAAGGTTGACGAGAATGATATAGAGAAAATGCCTTACTTAAACGCAGTTATAAAAGAGCTTTTACGTAAACACCCTCCAACATATTTCACATTGACCCATACAGTAACGGAGCCCGTTAAATTGGGCGGGTATGACATACCCATGGATACTAATGTGGAGTTTTTTGTACACGGGATCTCTCACGACCCGAACATATGGTCCGACCCGGATAAGTTTGACCCGGATAGGTTTTTATCGGGTCGGGAGGACGCGGATATAACGGGGGTGAAGGCGGTGAAGATGATGCCGTTCGGAGTCGGACGGAGGATTTGTCCGGGCTTGGGAATGGCAACGGTACATTTGAATTTGATGTTGGCGCGAATGGTTCAAGAATTTGAATGGTTGGCTTACCCGGGAAATAGTGAAGTGGATTTTAGTGAAAAATTGGAATTTACTGTGGTAATGAAGAATCCATTAAGAGCTAAAGTTAAGCCAAGAACATAATTAAGTAATGCTCATAATTAAGATTATAAGTCAAAAATTTGATTTATAAAACAAGGTTTGTAACATTTTTTCAATATTGTAATTACAATATTCCACATTTTCTTGTTTATAACATAAATAAAATCTTGTGAAGTTTATTTTGAAAAAAAAAAAAAAAGAAAAA

 

1164

 

45686

 

Contig23003

sgn|E367667/sgn|E366774/sgn|E251922/sgn|E226104/sgn|E239317/sgn|E238953/sgn|E246622/sgn|E294629/sgn|E268993/sgn|E397470/sgn|E296924/sgn|E244350/sgn|E347194

1104

TC177645 similar to UP|Q4VT47_VITVI (Q4VT47) RD22-like protein, partial (56%)

888

Show
Contig23003

Contig23003

 

sgn|E367667/sgn|E366774/sgn|E251922/sgn|E226104/sgn|E239317/sgn|E238953/sgn|E246622/sgn|E294629/sgn|E268993/sgn|E397470/sgn|E296924/sgn|E244350/sgn|E347194

 

1104

 

TC177645 similar to UP|Q4VT47_VITVI (Q4VT47) RD22-like protein, partial (56%)

 

888

 

1758

 

0

 

887

 

100

 

1104

 

AK106043|Os01g0733500 Dehydration-responsive protein RD22 precursor.

 

429

 

281

 

6.00E-76

 

233

 

58

 

1104

 

gb|AAV36561.1| RD22-like protein [Vitis vinifera]

 

364

 

337

 

8.00E-91

 

233

 

67

 

1104

 

SGN-U313803

 

1438

 

2101

 

0

 

1108

 

99

 

1104

 

Q08298|RD22_ARATH Dehydration-responsive protein RD22 precursor - Arabidopsis thaliana (Mouse-ear cress)

 

392

 

289

 

1.00E-77

 

234

 

61

 

1104

 

AT5G25610.1 | Symbol: None | dehydration-responsive protein (RD22), identical to SP:Q08298 Dehydration-responsive protein RD22 precursor {Arabidopsis thaliana} | chr5:8914236-8916724 REVERSE | Aliases: T14C9.150, T14C9_150

 

392

 

289

 

2.00E-78

 

234

 

61

 

AGAAGACAAAAGCACTTCAGTAGATGTAGGCAAAGGTGGAGTAAACGTCGGAGTCGACAAGGGCCACCACCACTCCGGTGGAACAAACGTCAACGTTGGAGGCAATAAAGGCGGCGTTAACGTGAACACTCCAGGTGGGACCCACGTAGGCGTTGGTAAAGGAGGAGTTGGTGTTACAACCCCCGGCCACCATGGAAAACCACCAGTCTCGGTGGGTGTTCACCCTGGACCCTCACCGTTTGTTTACAATTACGCGGCGAAAGACGATCAACTTAACGATAACCCTAACGTGGCGTTATTTTTCCTGGAAAAAGATTTGCATGAGGGAAGTAACATGAAGTTGAAGTTTGTGGAAAATGGCAATGGAGCTTCGTTTTTGCCCCGTCAAGAGGCGGATTCGATTCCGTTTAGCTCAGAGAAGATGCCGGAGATACTTCACAAGTTTTCAGTGGATGAGGATAGTGAAGAAGGTCAGATTATGAAGAAGACAGTAAGAGAATGTGAAGAGCCAGGTATTAAAGGAGAGGAGAAGTATTGTGCAACTTCATTAGAATCCATGATTGATTTCACCACATCAAAGTTAGGAAACAAAGTGCAACCATTATCAACAGAGACACAAAAAGAAAACACAGAAATGCAAAAATACACAATCCTAGGAGCCAAGAAAATGGGAAACAACAATGACAAATCAGTAGTTTGTCACAAACAAAACTATGCCTATGCAGTATTTTATTGTCACAAAACAGAAACAACAGAGTCATACATGGTATCATTAGTTGGTGTTGATGGAACAAAAGTTAAGGCTGTGGCTGTTTGTCACAAAGACACATCACAATGGAACCCAAAACATTTGGCTTTTAAAGTTCTTAAGGTTACACCTGGATCCGTCCCTGTTTGTCATTTCCTTCCACAAGATCACATTGTTTGGGTCCCTAAGAACTAGAAAATAATTAGATGACATATGTTTAATTGTCTTCTAAAAATTTGGGTTGTTTTTATGTATTATATGTAATAATACAAAGTATGTTGTGTTTGTCTTATACTTTTTGTCTTGTTGTATAATCATACTTTACTATACTAATAAATAATATATGTTTCACATTT

 

1104

 

45687

 

Contig23004

sgn|E366770/sgn|E254014

892

TC187351 similar to RF|NP_187354.1|15231353|NM_111578 ATP binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (41%)

1295

Show
Contig23004

Contig23004

 

sgn|E366770/sgn|E254014

 

892

 

TC187351 similar to RF|NP_187354.1|15231353|NM_111578 ATP binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (41%)

 

1295

 

1752

 

0

 

892

 

99

 

892

 

AK065776|Os03g0108600 DEAD/DEAH box helicase, N-terminal domain containing protein.

 

653

 

418

 

1.00E-117

 

297

 

68

 

892

 

dbj|BAD18438.1| unnamed protein product [Homo sapiens]

 

528

 

432

 

1.00E-119

 

276

 

75

 

892

 

SGN-U333004

 

892

 

1768

 

0

 

892

 

100

 

892

 

Q8GUG7|RH50_ARATH DEAD-box ATP-dependent RNA helicase 50 (EC 3.6.1.-) - Arabidopsis thaliana (Mouse-ear cress)

 

781

 

419

 

1.00E-117

 

276

 

74

 

892

 

AT3G06980.1 | Symbol: None | DEAD/DEAH box helicase, putative, contains Pfam profile: PF00270 DEAD/DEAH box helicase | chr3:2201473-2204839 FORWARD | Aliases: F17A9.13

 

781

 

419

 

1.00E-118

 

276

 

74

 

CGTGTTGTAATATTGGCACCAACAACTGAATTGGCTTCTCAGGTTTTAAATACTTGCCGTTCATTTTCAAAATCTGGTGTTCCATTCCGGTCTATGGTTGTTACTGGTGGCTTTCGCCAGAAAACTCAACTGGAGAACCTAAGACAGGAGTTGGACGTTCTTATTGCAACTCCTGGTCGGTTTATGTTTCTTATCAAAGAGGGTTACTTGCAGTTAACTAACCTCAAGTGTGCTGTGTTGGATGAGGTTGACATCCTCTTTAATGATGAGGATTTTGAGACTGCATTTCAATGCTTGATTAATTCATCACCTATCACCACACAATATCTATTTGTGACTGCTACTTTGCCCATGGACATATACAACAAGTTGGTAGAAAGTTTTCCTGATTGCGAACTAGTGACTGGTCCTGGTATGCATCGTACAAGCCCTGGCTTGGAAGAGGTCCTTGTAGATTGCAGTGGAGATGAAACAGCTGAAAAAAGTCCAGACACAGCTTTTCACAACAAAAAGAATGCCCTACTTCAGCTGGTGGAACGTAGCCCAGTTCCAAAAACAATCGTCTTCTGTAACAAGATTGATAGCTGCAGAAAAGTTGAGAACGCATTGAAGCGCTTTGATAGGAAAGGATTCGTGATAAAAGTCTTACCGTTCCATGCTGCACTGGACCAAGAAAGCAGACTTGCGAACATGAAGGAGTTTCGTAGCTCAAAGGCGGAGAATGTTTCTTTGTTCTTGGTGTGCACTGATAGAGCATCCCGAGGTATCGACTTTGAAGGTGTAGACCACGTAGTCCTCTTTGATTACCCTCGAGACCCTAGTGAATATGTACGTCGTGTTGGTAGAACTGCCAGGGGTGCTGGAGGAAAAGGAAAGGCATTCATATTTGCTG

 

892

 

45688

 

Contig23005

sgn|E366960/LEFL1032AB12

949

AW399128

643

Show
Contig23005

Contig23005

 

sgn|E366960/LEFL1032AB12

 

949

 

AW399128

 

643

 

1128

 

0

 

612

 

98

 

949

 

Os06g0571300|Os06g0571300 Conserved hypothetical protein.

 

436

 

91

 

1.00E-18

 

101

 

51

 

949

 

dbj|BAD42975.1| hypothetical protein [Arabidopsis thaliana]

 

200

 

114

 

9.00E-24

 

145

 

43

 

949

 

SGN-U342365

 

894

 

1134

 

0

 

612

 

98

 

949

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

949

 

AT2G45320.1 | Symbol: None | expressed protein | chr2:18691190-18693219 REVERSE | Aliases: F4L23.17

 

392

 

114

 

1.00E-25

 

145

 

43

 

TCAAATAGGTGCATCTACCATAAAACATTAGCAGTTGAAAGCCTTCACGCATATCAAACATATGTATACCAAAAAGCAACACTTCACAATACCAATCCTAGACAAGTTCTTTTGTAGGATCCATTAAGAGGTATGCGTAACACAGTAGCCTTAACCATCATTAGTTTTGACTATTTCAAAGTGAGATATGAAGAAAACAATAACCTTTTTTTTGTGGATAAAGTAGGAAGAAAACAAAAAACTTTCGAGGAGAGGTTTTCGAAAAATGATTTCTGCTGGTGTTTTGCCTGATTATCCAATTTTCATATCAGCAAAGCAGAGTTTATGGCATCAAAGTCTACTTGAGACTCTTAACAAGTACACAGGATTGATCTATAACGTCTTGCACATGGGTTTCCTGAATAAAATTAACAAAGACATTCAAGATGGCAATTGACCTTTCCACCTTGTTGTAGGAAATGTTCCCAACCGTAACACTGTCTAATGATTTGCCATTTGTCTGCTGATCAACATTATACGTGGCAAACACAGTGACAATGGAAATATTGCCTCCAGCCTTCAAATTATTAGAAGATGCTCCAATATGTGTCTTGGTGAGAGCTTTGTTGCCTTTGCACTGTAGCCGATCAGGCAACCCTTCGCCTGCAGCAGGTCCAAAAACCAGATGATCAAACTTCTTGTATTGTTTCCTTTGTGGAACTTCTGCAGCAGACTGCTGCCGTAGTTCTAAAACTGACATTATATGAACAAAAACAAAAAACAGAGGCAAACATAGAAGGAACGGGCGCCATCCACTGCACACTCTCTTTCCTATCATATCTTTGTAGGGAACACCAATTCCTAATACTATCCCAGCTTCAAAAAGCCAAAGGCCGGAATCCGATGGAGACTCAGTGAAGAGGCAATAGTGCCCGTCTAGTTGAGAGGATTTCGCCGGAAAAAATAATTC

 

949

 

45689

 

Contig23006

sgn|E366997/sgn|E365361

528

TC181664 similar to UP|Q41256_NICAL (Q41256) Arabinogalactan-protein, partial (26%)

534

Show
Contig23006

Contig23006

 

sgn|E366997/sgn|E365361

 

528

 

TC181664 similar to UP|Q41256_NICAL (Q41256) Arabinogalactan-protein, partial (26%)

 

534

 

983

 

0

 

528

 

98

 

528

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

528

 

gb|AAB35284.1| arabinogalactan-protein: AGP [Nicotiana alata]

 

461

 

114

 

2.00E-24

 

179

 

45

 

528

 

SGN-U319245

 

742

 

842

 

0

 

527

 

95

 

528

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

528

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TTCACTATGGGGTATATCATCAAGCAAGTGGTGTGCATTTTGTTCTTGGTGATTTCAACTCCATTTGTGCAAATTGAAGCTAGAAATAGCAAGTTTATGATCATTCCTACATCTCCTTCACCTGCTCCTACTCCGATTTCTAATGAAATTAGTTTCCCTCCTTTTTCATCGTTAAGTCCAACACCAGTACCAGCACCAGCACCAGCACCAACACCGGACTTTAATGATTTTGGATTTCCTCCTTTGTCGTTTTTAAGTCCAACACCATCACCAACACCATCACCGATAGAGGGTGATCAAGATCCTGGTTTGCCAACACCGGCGGGGGCACCGGAGGAAGGTGACATTGAAGCACCAGCACCACTTTTGGGTGACACTCCTTATGGACTTTATGGTCCTCATTCTCAGGAAGTTCCTTCTACTACTCTCACAAATTTTGATGATGTAGAAAAGGAATTACAAGGTGCCCGTTTCAACACGGACGAGTCCTACAATAACAATAACAACAACAATAACAATGGATACTCT

 

528

 

45690