KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Contig10216

sgn|E200801/sgn|E379003

734

p From {Arabidopsis thaliana} (exp=-1: wgp=-1: cg=-1), partial (31%)

592

Show
Contig10216

Contig10216

 

sgn|E200801/sgn|E379003

 

734

 

p From {Arabidopsis thaliana} (exp=-1: wgp=-1: cg=-1), partial (31%)

 

592

 

1035

 

0

 

559

 

98

 

734

 

Os05g0517900|Os05g0517900 Appr>p cyclic nucleotide phosphodiesterase domain containing protein.

 

185

 

174

 

6.00E-44

 

162

 

53

 

734

 

p cyclic nucleotide phosphodiesterase [Medicago truncatula] >gb|ABE80637.1| Appr>p cyclic nucleotide phosphodiesterase [Medicago truncatula]

 

184

 

219

 

8.00E-56

 

163

 

64

 

734

 

SGN-U333159

 

734

 

1402

 

0

 

734

 

98

 

734

 

O04147|CPD_ARATH Cyclic phosphodiesterase (EC 3.1.4.-) (CPDase) - Arabidopsis thaliana (Mouse-ear cress)

 

181

 

181

 

2.00E-45

 

165

 

52

 

734

 

AT4G18930.1 | Symbol: None | cyclic phosphodiesterase, identical to cyclic phosphodiesterase (Arabidopsis thaliana) gi:2065013:emb:CAA72363 | chr4:10370715-10372056 FORWARD | Aliases: F13C5.100, F13C5_100

 

181

 

181

 

4.00E-46

 

165

 

52

 

GCAGTTGCAACGCTTTATATGGTCGTATATGATTAATAACTCCTGGAAGTTTTGCAAAACCCAAAATATACAGAAAAAGGAAGCCCCAACAGCACAGTTTTCTCATGTATAAGACTTGAAAAAAGTTGCTGGCAATGAAAATTAAGGTAAAGATAAGGTACGCCGCGTTTTCTTGAGCAAAGAGTTTCAGCTCGCGGAGGGTTAAGAGTGTGGTTAGAACTAGTTAGTGCTAGCTGAGATTGTACTCTTCAATCTTCTCCCACGATTTAAGGCTTTTGTCTTCGGTGTCTGTTTTATACAATGCAAGGCGAGATATCTGGAAGCTTAAGTTGCCAATGCTCTCATCAAGGATATAAGCCTTCTCTTGAGCTTTCTTCTTTTCTTCATCCGTCAAATCGGCATAAAGAATGCTCATATGAGGCATATATGGACTTGAGCTGTTGTAACCAAAGCTGCTGCAGCAGCGTGCGCTAGCCTCCACAACCTCATTAGTAGGATGAAGCAAAAGATAAACACATTGATAAAAAAAAGTCCCAATATCAATTTTCTCCACAGTACCACTATACACCTTCTTCACCCCTTCACATCCTTTTCTAAACTTGTCACGTGCCTCTTCCTCCGTTAACCTCACCGCTCCGACGACAGTCACGTGAGGTTNCAATTGGGGCCCACCAAATTCCGATCTAAGACTACCCCATCATTTCTTAACCCTAACACTTACATCTTCCGATGGA

 

734

 

32900

 

Singlet896

FA32BA10

540

TC191359 homologue to UP|Q8LK04_SOLTU (Q8LK04) Glyceraldehyde 3-phosphate dehydrogenase , partial (43%)

582

Show
Singlet896

Singlet896

 

FA32BA10

 

540

 

TC191359 homologue to UP|Q8LK04_SOLTU (Q8LK04) Glyceraldehyde 3-phosphate dehydrogenase , partial (43%)

 

582

 

827

 

0

 

476

 

96

 

540

 

AK064960|Os04g0486600 Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 3 (EC 1.2.1.12).

 

337

 

125

 

2.00E-29

 

66

 

89

 

540

 

gb|AAM92008.1|AF527779_1 glyceraldehyde 3-phosphate dehydrogenase [Solanum tuberosum]

 

338

 

137

 

8.00E-43

 

66

 

100

 

540

 

SGN-U338561

 

1143

 

846

 

0

 

478

 

96

 

540

 

P09094|G3PC_TOBAC Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (EC 1.2.1.12) (Fragment) - Nicotiana tabacum (Common tobacco)

 

326

 

133

 

3.00E-31

 

66

 

96

 

540

 

AT1G13440.1 | Symbol: None | glyceraldehyde 3-phosphate dehydrogenase, cytosolic, putative / NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, putative, very strong similarity to SP:P25858 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic (EC 1.2.1.12) {Arabidopsis thaliana}: contains Pfam profiles PF02800: Glyceraldehyde 3-phosphate dehydrogenase C-terminal domain, PF00044: Glyceraldehyde 3-phosphate dehydrogenase NAD binding domain | chr1:4608220-4610565 REVERSE | Aliases: T6J4.17, T6J4_17

 

338

 

129

 

8.00E-31

 

66

 

92

 

GTTGTTTACACCATAACCTAATTTCTCTCTCTTACATCTTTGCTTAAGCTTTCATACTCTTTTTTTTTCTTAGCAATGGCAAACGGAAAGATCAAAATCGGAATCAACGGATTCGGTAGAATTGGTCGTTTGGTGGCTAGAGTTGCTCTACAGAGAGATGATGTTGAACTAGTTGCAGTGAATGATCCATTTATTTCCACTGATTACATGACATATATGTTTAAGTATGATTCAGTACATGGACAATGGAAGCATCATGAGCTAAAGGTCAAGGATGAGAAGACACTTCTCTTTGGAGAGAAGGCTGTTACAGTTTTTGGAATCAGGTATTTTTTTTGTTCCAGTGAATAAATCATTGTGTTTAGTTCAGTTTAGTTTTTTGCTGAAGGGATTTCGACTATTGTTAAGGAACCCTGAAGATATCCCATGGGGTGAAGCTGGTGCTGACTTCGTTGTTGAATCAACCGGTGTCTTCACTGACAAGG

 

485

 

896

 

Contig13122

sgn|E540896/sgn|E290680

625

TC191357 UP|Q8W214_SOLTU (Q8W214) Single-stranded DNA binding protein precursor, partial (7%)

828

Show
Contig13122

Contig13122

 

sgn|E540896/sgn|E290680

 

625

 

TC191357 UP|Q8W214_SOLTU (Q8W214) Single-stranded DNA binding protein precursor, partial (7%)

 

828

 

1142

 

0

 

584

 

99

 

625

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

625

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

625

 

SGN-U313569

 

625

 

1239

 

0

 

625

 

100

 

625

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

625

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TTCACAAGTTGGTCTCATTTTCCATCCAGAGGCTGGTTTTGTACCGGCTTAACATTGTGGGTTTCAATCCTCTAAATATTTTTCCCTTTGACTTGTCTTCACTAGTAGATATGTAATATACCGTCAATCTAATCTGGTATAATATCATTCATGAATCTATTTTGCATTCTTTTCTATAAACTTCTATATGATTTTCTTCTAGTAAAATGAGCTTTTATGATCGTACTTTTGATTGTTTTCCATGTTGAACTTTGTGTAGGATCTAGGTGGCCGGGCTATCCGCGTAAGTCCTGCTGAAGCTCGTCCACCCAGACGTCAATTCTGAAGATTGTAGCCAACATCTTTTTGACCGAGAAAAGGCTTGAGGGTCCAGGAGATGACGATAATTGCAGAAATGAATGAGTTATTAACTTTGCAACAGCTATATCTTAAACTTGCGCGGACAAACTACTCTCTACTTCTGGACTAACTAGAGCTCTCAAGTAAATTAGTTTTCGTAATGTATGTTCTGAAATTGCCTCAGGAAGATATCCCTGATCTTGTAATATGATTCTATCCATCACTTGTTGACAATCAAGACAATGAAAAAGTTTGATACTCTTCGAAAATGTATCTTAGCGCGAAC

 

625

 

35806

 

Contig10461

sgn|E233620/sgn|E320804/sgn|E550035

713

TC191356

620

Show
Contig10461

Contig10461

 

sgn|E233620/sgn|E320804/sgn|E550035

 

713

 

TC191356

 

620

 

1126

 

0

 

620

 

97

 

713

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

713

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

713

 

SGN-U323597

 

1312

 

1354

 

0

 

713

 

98

 

713

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

713

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

CTGCTACTTCCATAACTTTATTGAATGGGATAAGAAATAAGAGTTTTTATTAATTTATTTGAAACTTGTCAAAAAGAAGTGGGCTTCTTCTATTAATATAAATACTCCACTATATAGGAAGGCAAGCATGCAAGAAATATCTAGTTTGGTTACTCTCAGGTGACTGAGACTTGTGGTTTGTTGTTTATTTTAAGCCAATCGTTTTAGCTATCGTGTATTTTTTTTCTAGTTCGATCACTTTTTTGGACATCTCTATCTTTGGACCTCTTTTTATCTTTTTAGTTTGGGGCTACATTCCATCCCTAATAAATGTTGCAACATTGTGGTGTGGATAAGACAAGTCAAAGATAACTACGTGTCATTCTTATTGATAAAAGGATAAATTTATTCTTCTAACTAATCTCTCTAAGTTTTTAAATCAATAATTTCATTATTGATGTCCAATCGTGAGAGATGTGATTATGTTACTTTTGTATTGATCGTATCTGTAGCTAACTATGGATGGTGTACTCTTGTGTTGCGATTGTACGTAGTACACTGTTCTCTTATTTTCTTTTTATCTTAGATGAAATATTAAAAATATCTTTAGATTTGATATTAAATTATTAGTTTTATCTTTAAATTATTGACAATTTTTTCATTTATTTGATTAACTGAATTTNAACATATCATTGACTTTTGCATATGCGTNGAATATACTCCTAAATTTTTGA

 

713

 

33145

 

Singlet21059

sgn|E340540

710

TC191355 similar to UP|Q4V3C1_ARATH (Q4V3C1) At2g03070, partial (8%)

1154

Show
Singlet21059

Singlet21059

 

sgn|E340540

 

710

 

TC191355 similar to UP|Q4V3C1_ARATH (Q4V3C1) At2g03070, partial (8%)

 

1154

 

1247

 

0

 

671

 

98

 

710

 

AK069431|Os03g0423800 Conserved hypothetical protein.

 

273

 

92

 

3.00E-19

 

156

 

37

 

710

 

gb|AAC32925.1| unknown protein [Arabidopsis thaliana]

 

531

 

112

 

2.00E-23

 

159

 

48

 

710

 

SGN-U323489

 

1813

 

1304

 

0

 

688

 

98

 

710

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

710

 

AT2G03070.1 | Symbol: None | expressed protein | chr2:905618-908944 FORWARD | Aliases: T17M13.24, T17M13_24

 

524

 

112

 

3.00E-25

 

159

 

48

 

ACAGATGCAGTTCTCTCAGCCACTGGGAGCACAGCAGTTTCAAGGTAGGCAGCTACCATCTGGTGCCCTTCATCACGGTATGGGTCAAAGTCAGCTCAACCAAGGAAATCAGCTGAATCGACATTTAAACCAGTTTTCTAGTCCTATGAATACTGCACTATTCAATTCTGCCCAAAGCACACCTAGCTCTCAGATGATCTCAAATATGTCAGCAATGGTGCCATCACAAACTCTTCTGCCACGAATGCAGTTTGGAATGTCTGGTGGAACTCGGAATCTTGCTGCTGCAAACCTGAGTGATCAAATGTTCAATATGGGAGGAAACAATCCTGGTATGATGTCAATCCAACAGCAGCAGCATGGCACATTTGGAAACATGTCACAAAATACACAGAATCTGCAGCAGGGTATGATGCCTCTTCAGAACGCACCTCAGACCCACCCTTCCTTTCAGCAACAAAGACCACAAGGCCAACAGTGAAGTATCTAAGATTAGATGGAAGAGGAGGATATTTATACCAAACCTCAACATTTCCTAACTTTGTTTGATCTTTAAAAAAAAAATGTGAAGGCCAGATTCTTGCAGGAAATTTTTGTTGGAACATTACATTTGTTAAAAGAAGATTGTAAAATTACGTGCCTTGTACATTATTCAGTCGTAAATGTAAATCAGAAGATGATTGTTTGCTATTCCACATCTTTTTTTTAAA

 

710

 

21059

 

Singlet2161

LA21BG03

541

TC191354 homologue to UP|Q2LFC2_NICBE (Q2LFC2) AGO4-1 (Fragment), partial (21%)

1049

Show
Singlet2161

Singlet2161

 

LA21BG03

 

541

 

TC191354 homologue to UP|Q2LFC2_NICBE (Q2LFC2) AGO4-1 (Fragment), partial (21%)

 

1049

 

920

 

0

 

472

 

99

 

541

 

AK122078|Os04g0151800 Argonaute and Dicer protein, PAZ domain containing protein.

 

911

 

52

 

2.00E-07

 

27

 

77

 

541

 

emb|CAL57182.1| unnamed protein product [Ostreococcus tauri]

 

279

 

61

 

3.00E-08

 

56

 

60

 

541

 

SGN-U316063

 

1110

 

813

 

0

 

410

 

100

 

541

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

541

 

AT5G21150.1 | Symbol: None | PAZ domain-containing protein / piwi domain-containing protein, similar to SP:O04379 Argonaute protein (AGO1) {Arabidopsis thaliana}: contains Pfam profile: PF02170 PAZ (Piwi Argonaut and Zwille), PF02171 Piwi domain | chr5:7192242-7198327 FORWARD | Aliases: T10F18.180, T10F18_180

 

896

 

55

 

2.00E-08

 

27

 

92

 

CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACAAATTCAGACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTATCTACTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGAAGGGATGCATTTATTAGATAAAAGGTCGACGCGGGCTCTGCCCGTTGCTGCGATGATTCATGATAACTCGACGGATCGCACGGCCATCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGCCCGAGCATATAATAATATTCAGGGATGGTGTCAGTGAATCTCAGTTTAGTCAAGTTCTGAATGTTGAGCTGGACC

 

489

 

2161

 

Contig21774

sgn|E339053/sgn|E369651

791

TC191353 similar to UP|Q9SGU5_ARATH (Q9SGU5) T6H22.2 protein, partial (39%)

913

Show
Contig21774

Contig21774

 

sgn|E339053/sgn|E369651

 

791

 

TC191353 similar to UP|Q9SGU5_ARATH (Q9SGU5) T6H22.2 protein, partial (39%)

 

913

 

624

 

1.00E-178

 

344

 

97

 

791

 

AK101628|Os02g0169000 Conserved hypothetical protein.

 

374

 

131

 

6.00E-31

 

78

 

78

 

791

 

ref|NP_564711.1| unknown protein [Arabidopsis thaliana]

 

389

 

135

 

2.00E-30

 

81

 

80

 

791

 

SGN-U333203

 

791

 

1509

 

0

 

782

 

99

 

791

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

791

 

AT1G56180.1 | Symbol: None | expressed protein | chr1:21029569-21031729 REVERSE | Aliases: F14G9.20

 

389

 

135

 

2.00E-32

 

81

 

80

 

TTATTTATGGAGAGGCTGAAGGTGGAGAAAATGATGAAAATCTCTTCCGAAGCATCAGTATTCTTCTGGAACCCCCACTCTCTATGGCACAGATGTCAAATCAAGCAAGGTGGTCGCTGTTGCAATCTTATAATTTGCTGAAATGGCACAAACATGCACATCGAGCTGCTGTAAAAGCTATTGAGAATGGATGCAGTCTGAGCATGGTCATTAAAAAAATTGAGGAAGCCATGTCTCTGAAAAAATAAAGCAATATTTTGTACTAGAAGAGGTGACATTTAACCCTTATTCATGTGCAAAGGTCAGGATACTCATAAATGAATGGAACATTTTTTGGACAATTAAATGCGCGGACATTTAGCTGTGAGTAGATATTGTACTGCTATGAAATGCCTCAACTGGAGCTAGCAGGAAAGGGATTGAAGGTTCTTGGGCGCATAAATATGCTTGACCTTTGATCTTGCAGCGTGATAGTTCCTCAAAAGGAGCATGTTATATTTCTATGATTTTTAGATGAGCAGCTTAGGAGCAGAATTTTAAAAGTTTGGGAACAGAGAGAATCCTGCATCCTTTGATAAAGTAATGACCTCTTAGAACTTGTGTTTGCTGAAAAGAACAGAGGGAGGGAAGATATTTATCTTTTCGACCCAATATACTGCTGACTCCGCAAGGCAACAGCCAAATGAAGAGGCTGCTAGCCAATTGGGTTCTTTCCCACCTTTTCAGCTGTGATGATTATATAATGTATTCTCATAACTGAACTATCCATTTCCTTTTTCTTTAAAAAAAAA

 

791

 

44458

 

Contig12252

sgn|E390802/sgn|E236523/sgn|E389826/sgn|E378105/sgn|E550196/sgn|E390019/sgn|E309355

747

TC191352 UP|O24015_LYCES (O24015) Resistance complex protein I2C-1, complete

3978

Show
Contig12252

Contig12252

 

sgn|E390802/sgn|E236523/sgn|E389826/sgn|E378105/sgn|E550196/sgn|E390019/sgn|E309355

 

747

 

TC191352 UP|O24015_LYCES (O24015) Resistance complex protein I2C-1, complete

 

3978

 

567

 

1.00E-161

 

286

 

100

 

747

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

747

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

747

 

SGN-U322985

 

747

 

634

 

0

 

320

 

100

 

747

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

747

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GAGATCGATGGGGAATGCATGTAATGATTAAAACAAATGGCTCCCCAACTGATGTAAGCTATTCTTTTCCCTCATAAGCTTTTTATTTCACTTTGCTTTTTTGTTACTTCTTTTCATTTTTAATCATGCCGTGCTAGCTCATCATCAAACACATAGCATTATATTTAACCTCCATAGAGAATCTAAATTTTTTAAAGGATAACGATCACAAGTTTTAGGAAATAAGTGCAACTTCCATTGTCACATGTTATATAATTCTATATTTCTCATTGCTTATTGGTTTGTGCTCTTACCATGTTTTAATTCACGTCTCAATTGCCACCATGTTTAATCAATTGTCCGTAGGAAGTGTTTCTAAGGTGCTGTTGCTATTTTTACATCTGTTCCCGAGTTCTTTTTTTTTTCTTTTTGAACTTTCCACTAAAGCTATTATGTCGTCCACAGTGAATTTTCAGGTCTGTTGTTATAGGCAAGTCTTTGAGATGGGACTATCAAAGAAGGGCGATTACAATTAGTGTACCGCTGATATTATTTCATGTTTCCAGTGCAAGCCCCTTTTGTAAGTTGACAAACTCGATTAGTTAATATGTTTGGGACTCAACTAGTGGTTAGAGTACTCATTTTGTAAGATTTTTGTGTACAGAAAATCAAATTAGAATTATAACTCGTGATGGTTGAATAAACTCCAAGAAGTAGTGATATATTTTTATAGTGGATATGTTGTTTGCTCAAAAAAAAAAAAAAAAA

 

747

 

34936

 

Contig16003

sgn|E245207/sgn|E549889/sgn|E345622

1008

TC191351 similar to RF|NP_199184.1|15239952|NM_123737 alpha-mannosidase/ calcium ion binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (34%)

1071

Show
Contig16003

Contig16003

 

sgn|E245207/sgn|E549889/sgn|E345622

 

1008

 

TC191351 similar to RF|NP_199184.1|15239952|NM_123737 alpha-mannosidase/ calcium ion binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (34%)

 

1071

 

1998

 

0

 

1008

 

100

 

1008

 

AK067004|Os01g0773600 Glycoside hydrolase, family 47 protein.

 

684

 

404

 

1.00E-113

 

316

 

62

 

1008

 

ref|NP_199184.1| alpha-mannosidase/ calcium ion binding / mannosyl-oligosaccharide 1,2-alpha-mannosidase [Arabidopsis thaliana]

 

624

 

420

 

1.00E-116

 

310

 

66

 

1008

 

SGN-U344128

 

906

 

1160

 

0

 

585

 

100

 

1008

 

Q9BV94|EDEM2_HUMAN ER degradation-enhancing alpha-mannosidase-like 2 precursor - Homo sapiens (Human)

 

578

 

168

 

3.00E-41

 

215

 

41

 

1008

 

AT5G43710.1 | Symbol: None | glycoside hydrolase family 47 protein, similar to mannosyl-oligosaccharide 1,2-alpha-mannosidase IB (Mus musculus)(SP:P39098) | chr5:17569357-17573856 REVERSE | Aliases: MQD19.4, MQD19_4

 

624

 

420

 

1.00E-118

 

310

 

66

 

AAAAGGATGCTGGGATAGGGACGAGAAGCTTACAAGGCTGCTATGAACTATCTCTTTAGTGATCCTTGGTATGTAGAGGTAAATATGAATTCTGCTGCCCTTGTCTGGCCTTTATTTAACAGCTTACAGGCATTCTGGCCAGGTCTTCAGGTTCTGGCAGGGGATATCGAGCCTGCCATTAGAACACATGCTGCCTTCTTCAGCGTCTGGAAAAGATATGGTTTTACCCCAGAGGGTTTCAATCTAGCTACGCTCAGTGTTCAACAAGGCCAGAAAAGCTATCCTCTGCGTCCTGAATTGATTGAGAGCACCTATTGGCTGTACAAAGCTACCAGAGATCCTAGGTATCTTGATGCCGGAAGGGAAATTCTTGCTAGCTTGCAATATGGTGCGCGATGCACTTGTGGATATTGTCATATATCTGATGTTGAATTTCACAAACAAGAAGATCACATGGAGAGCTTCTTCTTGGCAGAAACTGTTAAATATTTGTGGCTTCTTTTTGATTTAGCTGCTGGTCCAGATAACCTGGTTGAGAATGGACCGTACAAGTATGTCTTCAGCACAGAAGGCCATTTATTGCCTGTAACTCCTCAAATATCCTTAGTACGTGAGCATTGTTCATACTTCGGAGCATATTGTAGGAACAGCAATTTGAGACTCAAAACTCATTCAGCCGTGAGTGCACAAACTAATTCCAGTGGCTCTCAAACACGACATGCAGATTCCAGTTTCTTATCGCGCTCCAGTTATCAAAGTTCTTCACCTGTCTCTGGTTTGAAGGTCAGAAATTTAATGGGACTCTGTCCTGGTCTAACCTATGAGCAAAGGTTTGGCATATCATTCATGTCTCCGGTGGATTCAAGTAGTGAGGATGAAAATTCAAGCCAAAGGAAGCCAACTGAAGTTCAGGGCCATTCACTTTTGCTGAACTCAAACCCCAATCCTGAAGTTTCCCTATCGGGTCCTCATAATGATCATGACAACAGCCCAGCTCGTGTGCCCCAA

 

1008

 

38687

 

Singlet3160

LC09AC04

334

TC191350

749

Show
Singlet3160

Singlet3160

 

LC09AC04

 

334

 

TC191350

 

749

 

488

 

1.00E-137

 

250

 

99

 

334

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

334

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

334

 

SGN-U342021

 

929

 

496

 

1.00E-140

 

250

 

100

 

334

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

334

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GGAACCTCAAAATCAGGGATGTATTTATGATTGCACAACCCCTTTATCTCTAGATGTTGGACAAAATAAAGATTCTAATGAAGTTGACTATGCTGGTGACTATAGTGCTGGTTTCTCACTGGATGAGAGTTCACACAGAGGATTGGGATTCTATGAAGAAGCAGAAATAACACATGGTGGAGTTGGATTGTCACCCAAGGATGAGAAGGAAAATCCTTCTTTTGAACATTCATTCTCTGACGAGGATATG

 

250

 

3160

 

Contig8660

LEFL1034BF11/sgn|E363886/LEFL1096CG03/LEFL2031I09/LEFL1093DE04/LEFL1077CB04/LEFL2018H16/LEFL2045O15

675

TC191350

749

Show
Contig8660

Contig8660

 

LEFL1034BF11/sgn|E363886/LEFL1096CG03/LEFL2031I09/LEFL1093DE04/LEFL1077CB04/LEFL2018H16/LEFL2045O15

 

675

 

TC191350

 

749

 

1160

 

0

 

661

 

97

 

675

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

675

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

675

 

SGN-U340502

 

879

 

1116

 

0

 

659

 

96

 

675

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

675

 

AT3G09850.1 | Symbol: None | D111/G-patch domain-containing protein, contains Pfam profile PF01585: G-patch domain | chr3:3023216-3025856 REVERSE | Aliases: F8A24.10

 

781

 

47

 

1.00E-05

 

205

 

26

 

ATCGAAAACTCACCACCGATCTCCGCCATCTGTCTCCGCCGTTCACGGCGTTTCGCCACTGTACACCGCCGAGTATGAAAAGCTGAATGAAATGGGAGGAAATAACAGAAAACGGTCTAATAAACCTAAAACCCGGAAGCCTAGGAACCCGTCTTATTCGGGTCGGGGCTTGTTTGTTGAAGGCGGAGTCTTATCTGATTGGGGCGATTTCAATTCTCCTCCTTCAAGAGGGAGAAATTTGAAGGGTGAATATGGAAATGGAAATGGTAATTCAAGGAATCGTAATGCAGCTGTTAGCAGCTCGAAGAATGCTTCGAGTTCGAAAACTGAATTGAAGAAGAGTAGAGGAAGTGAGATCCGTTATGTATACCCATCTGCAGATTCAGTGATACGTTCAGATGCAGTATGTAGTGGAGGAGTAAAAGATGTCAAGTTGGATTCGGAACATCCTATTCTTTTGGTTGATACAAAGGAAACTCAAATTATTGCTTTCGTAGATGAAGGCCCAAATAAGGAACCTCAAAATCAGGGATGTATTTATGATTGCACAACCCCTTTATCTCTAGATGTTGGACAAAATAAAGATTCTAATGAAGTTGACTATGCTGGTGACTATAGTGCTGGTTTCTCACTGGATGAGAGTTCACACAGATGATTGGGATTCTATGAAGAAGC

 

675

 

31344

 

Contig18117

sgn|E275139/sgn|E341692/sgn|E264575/sgn|E235945/LC22CG09/LC21BD07/LC08AD12/LC22BB08/LC11DF03

1639

TC191348 weakly similar to UP|Q8GU54_ORYSA (Q8GU54) SMC3 protein, partial (19%)

902

Show
Contig18117

Contig18117

 

sgn|E275139/sgn|E341692/sgn|E264575/sgn|E235945/LC22CG09/LC21BD07/LC08AD12/LC22BB08/LC11DF03

 

1639

 

TC191348 weakly similar to UP|Q8GU54_ORYSA (Q8GU54) SMC3 protein, partial (19%)

 

902

 

1735

 

0

 

903

 

99

 

1639

 

AJ535211|Os02g0133300 Structural maintenance of chromosome 3 (Fragment).

 

1154

 

627

 

1.00E-180

 

500

 

66

 

1639

 

gb|AAM15423.1| putative chromosome associated protein [Arabidopsis thaliana]

 

1175

 

630

 

1.00E-179

 

501

 

66

 

1639

 

SGN-U344851

 

930

 

1572

 

0

 

849

 

98

 

1639

 

O97594|SMC3_BOVIN Structural maintenance of chromosomes protein 3 (Chondroitin sulfate proteoglycan 6) - Bos taurus (Bovine)

 

1218

 

334

 

5.00E-91

 

511

 

39

 

1639

 

AT2G27170.1 | Symbol: None | similar to SMC2-like condensin, putative (SMC2) (TITAN3) [Arabidopsis thaliana] (TAIR:At5g62410.1): similar to cohesin complex subunit [Gallus gallus] (GB:NP_989848.1): similar to chondroitin sulfate proteoglycan 6 [Mus musculus] (GB:NP_031816.2): similar to putative SMC3 protein [Oryza sativa (japonica cultivar-group)] (GB:XP_464029.1): similar to putative SMC3 protein [Oryza sativa (japonica cultivar-group)] (GB:XP_464028.1): similar to chondroitin sulfate proteoglycan 6 (bamacan) [Homo sapiens] (GB:CAI16576.1): contains InterPro domain Structural maintenance of chromosome protein SMC, C-terminal (InterPro:IPR003405): contains InterPro domain SMC protein, N-terminal (InterPro:IPR003395) | chr2:11616397-11624509 REVERSE | Aliases: T22O13.6

 

1207

 

630

 

0

 

501

 

66

 

ATGAACTCGTGGCTGAGCAGCACAAAAATGATGCTGGCCTGGGTCACGACAAGTCTGAGTTAGAACAGCTTAAACAAGACATTCTTAATGCTGAAAGACAGACACAGTCCATCTTAAAAGCTCTTCAAAAGAAGGAGAAACTGCTTGGTAATATTCTGAGTCAAATAGATCAGCTCAGAGCTAGTATAGCTATGAAACAAGATGAAATGGGAACAGAACTTGTTGATCATTTAACGCCGGAAGAGCGAGATTCTTTGTCACGTTTGAACCCTGAAATCACGGCCCTGAAGGAGCAGCTGATTGCTTGCAGGGCAAATCGGATAGAGACTGAAACTAGAAAAGAGGAGCTTGAGATGAATCTGTCAACAAATCTTGAAAGACGAAAGCAAGAGTTAATGGCGATGAATTCTTCTGTCGACGTTGATATGCTACAGGCTGAAGTTGAGAGCAAGTATCAGGAACTCAAGGATGCGGACTCACTAGTTGATCATGTCACCAAAGAGCTTACAAGGGTTTCTCGAAATATAGATGAACGAAACAAGAGGCTCAAGCAGATCAAACAGGAAAAGGATAACCTGAAGGCTCTTGAAGATAAGTATCAGAATACACTTCAGGATGAAGCAAGAGAACTGGAACAGATGCTAAGTAAACGGAACACCTATCTTGCAAAGCAAGAAGATTACTCTAAGAAAATTCGGGAACTGGGTCCTTTATCTTCTGATGCCTTTGAGACGTACAAAAGAAAGAACGTAAAAGAATTATATAAGATGCTGCACAAGTGTAACGAGCAGCTGCAACAGTTCAGCCATGTAAATAAAAAGGCACTTGATCAATATGTAAACTTTACTGAGCAAAGAGAAGAAACTCCAAGAAGGCAAGCTGAACTGGATGCTGGGGATGAGAAAATCAAGGAACTTATATCTGTTTTGGATATGAGGAAGGATGAATCAATTGAGCGCACGTTCAAGGGTGTGGCTAAACATTTCCGTGAAGTATTCTCTCAGCTTGTACAAGGAGGTCACGGGTTCTTAGTTATGATGAAGAAAAAGGATGGTGAGGAAGATGACAATGATCCTGATGATGATGAGCCGCGTGCTGATGCAGAGGGAAGAGTTGAGAACTATATTGGTGTGAAAGTGAAGGTGTCGTTCACTGGACAAGGAGAAACACAGTCAATGAAACAGTTATCAGGGGGCCAGAAAACTGTGGTAGCACTGGCACTTATATTTGCCATACAAAGATGTGATCCTGCCCCATTTTATCTTTTTGATGAGATAGATGCAGCACTAGATCCTCAGTACAGAACAGCCGTGGGGAATATGGTTCGTGATTTGGCAGACAGGGGTAGCACGCAATTTATCACGACGACATTTCGCCCGGAGCTCGTGAAGGTGGCTGATAAGATATATAGTGTGAGCCACAAAAATAGAGTTAGCAAGGTCACTGTTGTATCCAGGGAAGGAGCCTTAGATTTTATTGAGCAGGATCAGTCACATAACTGACTGAGTCGCACAAGAGAGGTGTGGAGGGCTGGTGAAAGAAGCTTTTCTGCTACTGCGCTGCTTGTTATTTGCTGATGATTCGTTGTGGGATATGCTGAATCGTTGGTTGTGAAATATTGATGCTAATGTTTAATGTA

 

1639

 

40801

 

Singlet17461

sgn|E251561

459

TC191347 similar to UP|Q5N8G9_ORYSA (Q5N8G9) QUAKING isoform 5-like, partial (11%)

569

Show
Singlet17461

Singlet17461

 

sgn|E251561

 

459

 

TC191347 similar to UP|Q5N8G9_ORYSA (Q5N8G9) QUAKING isoform 5-like, partial (11%)

 

569

 

884

 

0

 

458

 

99

 

459

 

AK073986|Os05g0419500 KH domain containing protein.

 

291

 

83

 

7.00E-17

 

65

 

60

 

459

 

ref|NP_001055572.1| Os05g0419500 [Oryza sativa (japonica cultivar-group)]

 

291

 

83

 

4.00E-15

 

65

 

60

 

459

 

SGN-U315953

 

518

 

910

 

0

 

459

 

100

 

459

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

459

 

AT1G09660.2 | Symbol: None | KH domain-containing quaking protein, putative, similar to GB:AAC67357 | chr1:3127783-3131049 REVERSE | Aliases: None

 

264

 

71

 

2.00E-13

 

61

 

59

 

GAATTGGTTTCTTAGATGAATTTGGAGAATAGAATACCCCCTGGGAGTTACTTCCAGTACTCTCCAACTGGAATCCATGGTCCACTTCATAGGTCATCTTCTCTTACAGATCGTGAAAGATATTTGGCAGAGTTATTGGGGGAGAGGCAAAAATTGGGGCCATTCATGCAGATACTTCCTATATGCAATAGACTTCTAAACCAAGGTAGTAAATTGTAACCATGAGAACTTTTTATAATAGTTCTGGGTATCTCTATGTTGGAGCAGAAGATTCTTTCTTCTGTTGAAAGCTTTTTAAATGTTTTATCCCAACAAACTGTTTAATTGTTTGATGACGATAGCCTGATTGGTTAATTTAAAATAAAAGATGTAAATGATTGCATAGTTCAAACACCAGTCGTGGGCGGGCTTGGGCTTATCCTGTGTACGAAGTGCTTCTGGCTGGTGCAGGTGAGTGGG

 

459

 

17461

 

Singlet14450

sgn|E550859

518

TC191347 similar to UP|Q5N8G9_ORYSA (Q5N8G9) QUAKING isoform 5-like, partial (11%)

569

Show
Singlet14450

Singlet14450

 

sgn|E550859

 

518

 

TC191347 similar to UP|Q5N8G9_ORYSA (Q5N8G9) QUAKING isoform 5-like, partial (11%)

 

569

 

967

 

0

 

500

 

99

 

518

 

AK073986|Os05g0419500 KH domain containing protein.

 

291

 

83

 

9.00E-17

 

65

 

60

 

518

 

ref|NP_001055572.1| Os05g0419500 [Oryza sativa (japonica cultivar-group)]

 

291

 

83

 

5.00E-15

 

65

 

60

 

518

 

SGN-U315953

 

518

 

1027

 

0

 

518

 

100

 

518

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

518

 

AT1G09660.2 | Symbol: None | KH domain-containing quaking protein, putative, similar to GB:AAC67357 | chr1:3127783-3131049 REVERSE | Aliases: None

 

264

 

71

 

3.00E-13

 

61

 

59

 

GTAGAATTGGTTTCTTAGATGAATTTGGAGAATAGAATACCCCCTGGGAGTTACTTCCAGTACTCTCCAACTGGAATCCATGGTCCACTTCATAGGTCATCTTCTCTTACAGATCGTGAAAGATATTTGGCAGAGTTATTGGGGGAGAGGCAAAAATTGGGGCCATTCATGCAGATACTTCCTATATGCAATAGACTTCTAAACCAAGGTAGTAAATTGTAACCATGAGAACTTTTTATAATAGTTCTGGGTATCTCTATGTTGGAGCAGAAGATTCTTTCTTCTGTTGAAAGCTTTTTAAATGTTTTATCCCAACAAACTGTTTAATTGTTTGATGACGATAGCCTGATTGGTTAATTTAAAATAAAAGATGTAAATGATTGCATAGTTCAAACACCAGTCGTGGGCGGGCTTGGGCTTATCCTGTGTACGAAGTGCTTCTGGCTGGTGCAGGTGAGTGGGCGATTGGGCATATACTGTTCGCAATATTCCCATAGCGTTTCTGCAAAGAGATAGTT

 

518

 

14450

 

Singlet20512

sgn|E331376

523

TC191346 similar to GB|BAB71852.1|16902294|AB062739 kinesin-related protein {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (20%)

778

Show
Singlet20512

Singlet20512

 

sgn|E331376

 

523

 

TC191346 similar to GB|BAB71852.1|16902294|AB062739 kinesin-related protein {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (20%)

 

778

 

1029

 

0

 

523

 

99

 

523

 

Os10g0512800|Os10g0512800 kinesin-like protein [Oryza sativa (japonica cultivar-group)].

 

880

 

154

 

4.00E-38

 

202

 

48

 

523

 

gb|ABE89527.1| Kinesin, motor region: Zinc finger, RING-type: tRNA-binding arm: RINGv [Medicago truncatula]

 

1073

 

202

 

6.00E-51

 

198

 

59

 

523

 

SGN-U346611

 

1067

 

1037

 

0

 

523

 

100

 

523

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

523

 

AT4G39050.1 | Symbol: None | kinesin-related protein (MKRP2), kinesin motor protein - Ustilago maydis, PID:g2062750: identical to cDNA MKRP2 mRNA for kinesin-related protein GI:16902293, kinesin-related protein (Arabidopsis thaliana) GI:16902294 | chr4:18193129-18200691 FORWARD | Aliases: F19H22.150, F19H22_150

 

1055

 

199

 

1.00E-51

 

179

 

60

 

GAGGCTAACTAAACTGATCCTTGTTTCTTCAGAGAATTCAACTCCTGGTTATTTGGGTGATGTTGCTTCTCAACAAAGGAGTCTGTCCGCTTCTGAAGATGATAAAATGGACAGTTCTGTGCTCGCAGATAGCGAGAATCAGAAAGACCCTTCGCCAGATAGTTCTGATTTGAAACACCAAAGATCCTCTAGCAAGTGGAATGATGATATATCACAGGCTGGAAGTACCATAGAAGGTATCTCAATGTCAGATGAAATGGACCTCCTGGCTGAGCAAGTTAAGATGCTTAGCGGAGAGATTGCATTCAGCAGCAGTACATTGAAGCGGTTGATGGAGCAATCTGTAAATGATCCTGAGAGTTCAAGAAACCAAATTGAAAATTTAGAGCGTGAAATCCAAGAAAAGAGAAATCAAATGAGGATGCTGGAACAGCGCATTGTTGAAAACGGTGAAGCGTCAGTTTCAAAAGCATCGTTAGTAGAAATGCAGCAGACTCTGATGAAATTGATGACACAGTATAGT

 

523

 

20512