KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Contig18908

sgn|E306768/sgn|E544137

804

3)-beta-glucan endohydrolase A), partial (8%)

604

Show
Contig18908

Contig18908

 

sgn|E306768/sgn|E544137

 

804

 

3)-beta-glucan endohydrolase A), partial (8%)

 

604

 

1049

 

0

 

604

 

95

 

804

 

AK105972|Os01g0940800 Beta-1,3-glucanase precursor.

 

332

 

79

 

5.00E-15

 

65

 

56

 

804

 

3)-beta-glucan endohydrolase A) ((1->3)-beta-glucanase A) (Acidic beta-1,3-glucanase) (Beta-1,3-endoglucanase A)

 

336

 

139

 

2.00E-31

 

70

 

97

 

804

 

SGN-U317666

 

804

 

1445

 

0

 

804

 

96

 

804

 

3)-beta-glucanase A) (Acidic beta-1,3-glucanase) (Beta-1,3-endoglucanase A) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

336

 

139

 

1.00E-32

 

70

 

97

 

804

 

AT3G57260.1 | Symbol: None | glycosyl hydrolase family 17 protein, similar to glucan endo-1,3-beta-glucosidase, acidic isoform precursor SP:P33157 from (Arabidopsis thaliana) | chr3:21199496-21200838 REVERSE | Aliases: F28O9.110, BETA-1,3-GLUCANASE

 

339

 

80

 

2.00E-15

 

74

 

52

 

TCGGCACGAGGTTTGCTATGGCTTTTCTAAGTTCTCTCTTAGCTTCCCTTTTACTTGTTGGGCTTCTAATCCAAATAACAGGTAAATCTCTTACCTACAACTCACGTACAATTAGACAAATTCAAGATTTAAATTTCTATAAGTTCAGTTTTTAGGAATTTCAGTATTGAACTCGTTGTATTTAAAATTTTGGAAACCTACTATTTGTTTCAATTTTAGTAACGTTTTATACATATATTTATGTCCCGTATTAGAAGTACTGAATTCAAATGAATCGCCCTTTGCTTGTCTCATGCATGCACATTATTTACTTATATAAATGTCATATTAAATAACACTATATATGTATATATATTTTTTTTCTAGGCCCTAGTGATAAGGACATTAAAAAATAGGTTTAATGGTCTTACGCAATTGTGACATCTACAAATAAGTTAATTATGGACGTATTAACCAACCATTAGAGATTTTTTTATGTTTAATTTTATAATTAGTAAAGATTCACATTATCGACATCAACTTGTTTTCATTTAAGCGTTATTATTGTTGTGTTACTATTATTTTGACGTTCTTTTTTTTTTGTCATAATGTAGGAGCGCAGCCTATCGGAGTATGTTATGGAAAAATTGCCAATAATTTACCATCGGATCAAGATGTCATAAAATTATATAATTCGAATAACATCAAGAAAATGAGAATTTACTTTCCAGAAACAAATGTCTTTAATGCCCTCAAAGGAAGTAACATTGAAAATATTCTTGATGTCCCAAATCAAGATCTTGAAGCCCTAGCCACTCCTTCAAA

 

804

 

41592

 

Singlet15886

sgn|E211721

496

3)-beta-glucan endohydrolase B), partial (27%)

398

Show
Singlet15886

Singlet15886

 

sgn|E211721

 

496

 

3)-beta-glucan endohydrolase B), partial (27%)

 

398

 

789

 

0

 

398

 

100

 

496

 

AF030166|

 

334

 

110

 

5.00E-25

 

111

 

47

 

496

 

3)-beta-glucan endohydrolase B) ((1->3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B)

 

360

 

243

 

3.00E-63

 

137

 

88

 

496

 

SGN-U312944

 

1508

 

658

 

0

 

332

 

100

 

496

 

3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

360

 

243

 

3.00E-64

 

137

 

88

 

496

 

AT4G16260.1 | Symbol: None | glycosyl hydrolase family 17 protein, similar to glucan endo-1,3-beta-glucosidase, basic vacuolar isoform precursor SP:P52407 from (Hevea brasiliensis) | chr4:9200025-9201544 REVERSE | Aliases: DL4170C, FCAALL.386

 

306

 

127

 

3.00E-30

 

105

 

57

 

CGGCTCTTAATTTCATTACACTAATTAAGACTTAGTTATAAATAGCTCTTAATCCATCTTAGTTTGTACCAATAACATTACTTCTCATCAAACATCATGGCTACCTCACAAATAGCTATTATTGTGCTTCTAGGATTACTTGTCGCCACCAACATTCACATAACAGGTGTTTGTTATGGAATGATGGGGAACAACTTGCCATCACATTCTGAAGTTATACAGCTCTACAAGTCGAGAAACATTAGAAGACTGAGGCTTTATGATCCAAATCATGGAGCTTTGAATGCGCTAAGAGGATCAAACATTGAAGTGATATTAGGACTTCCAAATGTAGATGTGAAACACATTTCTTCTGGGATGGAACACGCGAGATGGTGGGTACAGAAGAACGTTAGAGATTTCTGGCCTCATGTTAAAATTAAGTATATAGCTGTTGGTAATGAAATCAGCCCTGTTACTGGCACTTCCAATCTTGCCCCATTTCAAGTTCCTGCTT

 

496

 

15886

 

Singlet15532

sgn|E204440

510

3)-beta-glucan endohydrolase B), partial (6%)

502

Show
Singlet15532

Singlet15532

 

sgn|E204440

 

510

 

3)-beta-glucan endohydrolase B), partial (6%)

 

502

 

617

 

1.00E-176

 

338

 

97

 

510

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

510

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

510

 

SGN-U334038

 

791

 

617

 

1.00E-176

 

338

 

97

 

510

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

510

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

ACATCATGGCTACCTCACAAATAGCTATTATTGTGCTTCTAGGATTACTTGTCGCCACCAACATTCACATAACAGGTTTCTACTTAAACATTTTGAATTTTCGACATCAAAAATAATATTATTGATAGTTTTTTTTTACCGTATACTCTTAATTGTGTATCTTTTCCCACACTAACTTGCATGACTATATTCATTTTACCCAAAGTTACTTGACATTTTTCGGTTTTAGCACTCACAAACTTTTTTAATTTGAGGGTGGTCAGCAGAGGTGAATCCAAAATTTAAATCGAAGTCAAAATCTAATATTTATATATTTTCTTCGTTTCAAAAATAATGTCTTTTTTTTTTAGTTTGTTTAAAAAAAAGGACCCCTTTCTTTATTTGACAACAATTTAACTTTAACTTTCCACATTACATGTTTAAGAACACAAGATTAAAGAAAATTTTGGTATATTTGACATAAGTTTAATTTTGGACCACAAGATTAAAAAATCTATTTTCTTTTTTCTT

 

510

 

15532

 

Singlet13337

sgn|E375798

660

3)-beta-glucan endohydrolase B), partial (6%)

502

Show
Singlet13337

Singlet13337

 

sgn|E375798

 

660

 

3)-beta-glucan endohydrolase B), partial (6%)

 

502

 

617

 

1.00E-176

 

338

 

97

 

660

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

660

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

660

 

SGN-U334038

 

791

 

617

 

1.00E-176

 

338

 

97

 

660

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

660

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

ACATCATGGCTACCTCACAAATAGCTATTATTGTGCTTCTAGGATTACTTGTCGCCACCAACATTCACATAACAGGTTTCTACTTAAACATTTTGAATTTTCGACATCAAAAATAATATTATTGATAGTTTTTTTTTACCGTATACTCTTAATTGTGTATCTTTTCCCACACTAACTTGCATGACTATATTCATTTTACCCAAAGTTACTTGACATTTTTCGGTTTTAGCACTCACAAACTTTTTTAATTTGAGGGTGGTCAGCAGAGGTGAATCCAAAATTTAAATCGAAGTCAAAATCTAATATTTATATATTTTCTTCGTTTCAAAAATAATGTCTTTTTTTTTTAGTTTGTTTAAAAAAAAGGACCCCTTTCTTTATTTGACAACAATTTAACTTTAACTTTCCACATTACATGTTTAAGAACACAAGATTAAAGAAAATTTTGGTATATTTGACATAAGTTTAATTTTGGACCACAAGATTAAAAAATCTATTTTCTTTTTTCTTATATTCCGTTCCAAATTAAACTATGCTAATCTTTTTAAAACGGATGGAGTACTTATTTAGTGAACTTTTTTTTGAGACGTAAACAATTTTTGAGCTAAAGCTATTAGATTCGGAGGAACCAGTAATTAATTACATCTGCCCTAGCATGTG

 

660

 

13337

 

Singlet13099

sgn|E378910

679

3)-beta-glucan endohydrolase B), partial (6%)

502

Show
Singlet13099

Singlet13099

 

sgn|E378910

 

679

 

3)-beta-glucan endohydrolase B), partial (6%)

 

502

 

617

 

1.00E-176

 

338

 

97

 

679

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

679

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

679

 

SGN-U334038

 

791

 

617

 

1.00E-176

 

338

 

97

 

679

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

679

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

ACATCATGGCTACCTCACAAATAGCTATTATTGTGCTTCTAGGATTACTTGTCGCCACCAACATTCACATAACAGGTTTCTACTTAAACATTTTGAATTTTCGACATCAAAAATAATATTATTGATAGTTTTTTTTTACCGTATACTCTTAATTGTGTATCTTTTCCCACACTAACTTGCATGACTATATTCATTTTACCCAAAGTTACTTGACATTTTTCGGTTTTAGCACTCACAAACTTTTTTAATTTGAGGGTGGTCAGCAGAGGTGAATCCAAAATTTAAATCGAAGTCAAAATCTAATATTTATATATTTTCTTCGTTTCAAAAATAATGTCTTTTTTTTTTAGTTTGTTTAAAAAAAAGGACCCCTTTCTTTATTTGACAACAATTTAACTTTAACTTTCCACATTACATGTTTAAGAACACAAGATTAAAGAAAATTTTGGTATATTTGACATAAGTTTAATTTTGGACCACAAGATTAAAAAATCTATTTTCTTTTTTCTTAAATTCCGTTCCAAATTAAACTAGGCTAATCTTTTTAAAACGGATGGAGTACTTATTTAGTGAACTTTTTTTTGAGACGTAAACAATTTTGAGCTNAAGCTATTAGATTCGGAGGAACCAGTAATTAATTACATCTGCCCTAGCATGTGTTTCTTTAAATTTTTCAAGT

 

679

 

13099

 

Contig5565

sgn|E200846/sgn|E205077/sgn|E209016/sgn|E200279/sgn|E201177/sgn|E204829/LEFL1012AF02/LEFL1061DC01/sgn|E201857/sgn|E201855/sgn|E330160/LEFL1068CG05/LEFL1050DF07/sgn|E205405/sgn|E374967/sgn|E205819/sgn|E206503/sgn|E544136/sgn|E354230/sgn|E374966/sgn|E289190

1255

3)-beta-glucanase A) (Acidic beta-1,3-glucanase) (Beta-1,3-endoglucanase A) , complete

1208

Show
Contig5565

Contig5565

 

sgn|E200846/sgn|E205077/sgn|E209016/sgn|E200279/sgn|E201177/sgn|E204829/LEFL1012AF02/LEFL1061DC01/sgn|E201857/sgn|E201855/sgn|E330160/LEFL1068CG05/LEFL1050DF07/sgn|E205405/sgn|E374967/sgn|E205819/sgn|E206503/sgn|E544136/sgn|E354230/sgn|E374966/sgn|E289190

 

1255

 

3)-beta-glucanase A) (Acidic beta-1,3-glucanase) (Beta-1,3-endoglucanase A) , complete

 

1208

 

2363

 

0

 

1204

 

99

 

1255

 

3)-beta-glucanase isoenzyme GV) (Beta-1,3- endoglucanase GV).

 

318

 

287

 

1.00E-77

 

319

 

48

 

1255

 

3)-beta-glucan endohydrolase A) ((1->3)-beta-glucanase A) (Acidic beta-1,3-glucanase) (Beta-1,3-endoglucanase A)

 

336

 

649

 

0

 

336

 

94

 

1255

 

SGN-U317665

 

1239

 

2375

 

0

 

1206

 

99

 

1255

 

3)-beta-glucanase A) (Acidic beta-1,3-glucanase) (Beta-1,3-endoglucanase A) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

336

 

649

 

0

 

336

 

94

 

1255

 

AT3G57260.1 | Symbol: None | glycosyl hydrolase family 17 protein, similar to glucan endo-1,3-beta-glucosidase, acidic isoform precursor SP:P33157 from (Arabidopsis thaliana) | chr3:21199496-21200838 REVERSE | Aliases: F28O9.110, BETA-1,3-GLUCANASE

 

339

 

307

 

8.00E-84

 

321

 

51

 

ACACAATTTCACCTCTAACTATTTCTTACTCTTCTCAATTTCCAATTTTGCTATGGCTTTTCTAAGTTCTCTCTTAGCTTCCCTTTTACTTGTTGGGCTTCTAATCCAAATAACAGGAGCGCAGCCTATCGGAGTATGTTATGGAAAAATTGCCAATAATTTACCATCGGATCAAGATGTCATAAAATTATATAATTCGAATAACATCAAGAAAATGAGAATTTACTTTCCAGAAACAAATGTCTTTAATGCCCTCAAAGGAAGTAACATTGAAATAATTCTTGATGTCCCAAATCAAGATCTTGAAGCCCTAGCCACTCCTTCAAACGCCAACGGTTGGGTTCAAGATAATATAAGAAATCATTTTCCGGATGTTAAATTCAAATATATAGCCGTTGGAAACGAAGTTGATCCAGGTAGAGACAGTGGTAAATACGCACGATTTGTTGGTCCAGCAATGGAAAATATTTACAACGCGTTATCATCAGCAGGGTTGCAAAATCAAATCAAGGTCTCAACCGCGACATATTTAGGGCTTTTAACCAACACCTACCCACCTAGAGATAGCATTTTTCGCGATGAATATAAAAGTTTCATCAATCCCATAATTGGATTTCTATCAAGACATAATCTTCCACTTTTAGCCAATATTTACCCTTATTTTGGCCATGCTGATGATAATGTTCCTCTTCCTTATGCACTTTTCAAGCAACAAGGGCTAAACGATGCAGGATATCAAAATCTTTTCGATGCCCTTGTGGATTCAATGTATTTTGCTACTGAGAAACTTGGAGGACAAAATATTGAGATTATTGTATCGGAAAGTGGTTGGCCTTCTGAAGGACACCCTTCCGCTACTCTTGAAAACGCGATGACTTATTATACAAACTTGATTAATCATGTGAAAGGAGGGGCAGGAACACCAAAGAAACCAGGAAGGACTATAGAAACCTATTTATTCGCCATGTTTGATGAAAATAGAAAGGATGGAAAACCAAGTGAGCAACATTTTGGACTCTTTAAACCTGACCAGAGGCCAAAGTATCAACTCAAATTTGATTAATGATACCATATTATAATCAATATATAGATATTTTATGTTATGGATATGAATAATCAATAAATGATAGTATATGTGAGAAAAATGTATGGCCTCTTTTGTGTTCCTTGATATCATAACATTAATATTGAAGTATTTTTAATAAAATAGGGATTTTTATTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

 

1255

 

28249

 

Singlet14432

sgn|E376147

735

3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B) , complete

1377

Show
Singlet14432

Singlet14432

 

sgn|E376147

 

735

 

3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B) , complete

 

1377

 

783

 

0

 

395

 

100

 

735

 

3)-beta-glucanase isoenzyme GV) (Beta-1,3- endoglucanase GV).

 

318

 

125

 

4.00E-29

 

124

 

52

 

735

 

3)-beta-glucan endohydrolase B) ((1->3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B)

 

360

 

270

 

4.00E-71

 

138

 

96

 

735

 

SGN-U334037

 

911

 

977

 

0

 

493

 

100

 

735

 

3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

360

 

270

 

3.00E-72

 

138

 

96

 

735

 

AT4G16260.1 | Symbol: None | glycosyl hydrolase family 17 protein, similar to glucan endo-1,3-beta-glucosidase, basic vacuolar isoform precursor SP:P52407 from (Hevea brasiliensis) | chr4:9200025-9201544 REVERSE | Aliases: DL4170C, FCAALL.386

 

306

 

157

 

6.00E-39

 

131

 

58

 

CGGGCAGGTACCACTACATTAGGTGCTGTAAAAAGAGCATACGGAAGTGAAATCTGTCCTGGATTACCAGAATAGCTAAAATAAGGATAAATGTTAACGAGCAAAGGTGCACGTGTATCCCTCAAAAACCCAACAATTGGATCAGTAAACCATCTAACATCGTTCCTAAATGAACCCTGTGATGGTGGATAAGAATTGCCAATCAACGTCATGTCTACAGACGTTGAGACCTTAATGTCATTTCCCAAACCAGCTTCACCGATTGCTTTGTAAATGTTAACCAAAGCAGGAACTTGAAATGGGGCAAGATTGGAAGTGCCAGTAACAGGGCTGATTTCATTACCAACAGCTATATACTTAATTTTAACATGAGGCCAGAAATCTCTAACGTTCTTCTGTACCTCGGCCCCGAGGTGCCCCATTTCCCCTCATGGGACAGTTTCTTGGTATTTTTAGCTTTGATTAGTTTCAGACCTTGGTTTGGGTTTATGAATTTTTTTTGTTTCTTTTGTTTTTGTGGCTTATTTTAGGCAATTGCCTTTTTCCTTGTCGAGTTACATGGGTTTTAGATGAGGGTTTTTGTTATATTAGTCTATCTTATCAATCTGTTGTGTCAGTTCAGCATTGCTTTCCCCCCTTTAAACTACTGGTTAAAGCTAGAAACTAGGTCGGAGTGCATTGCGAAATAGTTGAACTTTGAAGTTGTCGAAAAAAAAAAAAAAAAAAAAAAAAAAA

 

735

 

14432

 

Contig16809

sgn|E204918/sgn|E201301/sgn|E208467/sgn|E205117/sgn|E201203/sgn|E204345/sgn|E200932/sgn|E204342/sgn|E212782/sgn|E207271/sgn|E205628/sgn|E207508/sgn|E200834/sgn|E214517/sgn|E201189/sgn|E205446/sgn|E201032/sgn|E201023/sgn|E200765/sgn|E204747/sgn|E204199/sgn|E213239/sgn|E201279/sgn|E205025/sgn|E201405/sgn|E208849/sgn|E208149/sgn|E207277/sgn|E207183/sgn|E208239/sgn|E203713/sgn|E209315/sgn|E264928/sgn|E208944/sgn|E209066/sgn|E205632/sgn|E334831/sgn|E200668/sgn|E204669/sgn|E209311/sgn|E200268/sgn|E201163/sgn|E209210/sgn|E211742/sgn|E207296/sgn|E201603/sgn|E207704/sgn|E207076/sgn|E208598/sgn|E201261/sgn|E203946/sgn|E200683/sgn|E207452/sgn|E200069/sgn|E207177/sgn|E210441/sgn|E201282/sgn|E208588/sgn|E207201/sgn|E205534/sgn|E209067/sgn|E206573/sgn|E201236/sgn|E212923/sgn|E337911/sgn|E201969/sgn|E200892/sgn|E209153/sgn|E213048/sgn|E215143/sgn|E208776/sgn|E214590/sgn|E206002/sgn|E209682/sgn|E212679/sgn|E213043/sgn|E303519/sgn|E205657/sgn|E200711/sgn|E338364/sgn|E201548/sgn|E208241/sgn|E208699/sgn|E205368/sgn|E209249/sgn|E210139/sgn|E208583/sgn|E201051/sgn|E202508/sgn|E205121/sgn|E209498/sgn|E206608/sgn|E206162/sgn|E304117/sgn|E205845/sgn|E206836/sgn|E209314/sgn|E210432/sgn|E209351/sgn|E204458/sgn|E209523/sgn|E209361/sgn|E203779/sgn|E205294/sgn|E206236/sgn|E305489/sgn|E211943/sgn|E211983/sgn|E208952/sgn|E205375/sgn|E204032/sgn|E212000/sgn|E214699/sgn|E204762/sgn|E205750/sgn|E204059/sgn|E209413/sgn|E209675/sgn|E204261/sgn|E209166/sgn|E207634/sgn|E209129/sgn|E267837/sgn|E341175/sgn|E285815/sgn|E209637/sgn|E209106/sgn|E205060/sgn|E298196/sgn|E293674/sgn|E335865/sgn|E335584/sgn|E212266/sgn|E200065/sgn|E209293/sgn|E207530/sgn|E203994/sgn|E209041/sgn|E201199/sgn|E209626/sgn|E203857/sgn|E209556/sgn|E206983/sgn|E202543/sgn|E200970/sgn|E205371/sgn|E201716/sgn|E204264/sgn|E200931/sgn|E205464/sgn|E205760/sgn|E206378/sgn|E310843/sgn|E202375/sgn|E306446/sgn|E204376/sgn|E209603/sgn|E206435/sgn|E204701/sgn|E209109/sgn|E207935/sgn|E208857/sgn|E210570/sgn|E203967/sgn|E209448/sgn|E207102/sgn|E202648/sgn|E208854/sgn|E202424/sgn|E207098/sgn|E215

1506

3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B) , complete

1377

Show
Contig16809

Contig16809

 

sgn|E204918/sgn|E201301/sgn|E208467/sgn|E205117/sgn|E201203/sgn|E204345/sgn|E200932/sgn|E204342/sgn|E212782/sgn|E207271/sgn|E205628/sgn|E207508/sgn|E200834/sgn|E214517/sgn|E201189/sgn|E205446/sgn|E201032/sgn|E201023/sgn|E200765/sgn|E204747/sgn|E204199/sgn|E213239/sgn|E201279/sgn|E205025/sgn|E201405/sgn|E208849/sgn|E208149/sgn|E207277/sgn|E207183/sgn|E208239/sgn|E203713/sgn|E209315/sgn|E264928/sgn|E208944/sgn|E209066/sgn|E205632/sgn|E334831/sgn|E200668/sgn|E204669/sgn|E209311/sgn|E200268/sgn|E201163/sgn|E209210/sgn|E211742/sgn|E207296/sgn|E201603/sgn|E207704/sgn|E207076/sgn|E208598/sgn|E201261/sgn|E203946/sgn|E200683/sgn|E207452/sgn|E200069/sgn|E207177/sgn|E210441/sgn|E201282/sgn|E208588/sgn|E207201/sgn|E205534/sgn|E209067/sgn|E206573/sgn|E201236/sgn|E212923/sgn|E337911/sgn|E201969/sgn|E200892/sgn|E209153/sgn|E213048/sgn|E215143/sgn|E208776/sgn|E214590/sgn|E206002/sgn|E209682/sgn|E212679/sgn|E213043/sgn|E303519/sgn|E205657/sgn|E200711/sgn|E338364/sgn|E201548/sgn|E208241/sgn|E208699/sgn|E205368/sgn|E209249/sgn|E210139/sgn|E208583/sgn|E201051/sgn|E202508/sgn|E205121/sgn|E209498/sgn|E206608/sgn|E206162/sgn|E304117/sgn|E205845/sgn|E206836/sgn|E209314/sgn|E210432/sgn|E209351/sgn|E204458/sgn|E209523/sgn|E209361/sgn|E203779/sgn|E205294/sgn|E206236/sgn|E305489/sgn|E211943/sgn|E211983/sgn|E208952/sgn|E205375/sgn|E204032/sgn|E212000/sgn|E214699/sgn|E204762/sgn|E205750/sgn|E204059/sgn|E209413/sgn|E209675/sgn|E204261/sgn|E209166/sgn|E207634/sgn|E209129/sgn|E267837/sgn|E341175/sgn|E285815/sgn|E209637/sgn|E209106/sgn|E205060/sgn|E298196/sgn|E293674/sgn|E335865/sgn|E335584/sgn|E212266/sgn|E200065/sgn|E209293/sgn|E207530/sgn|E203994/sgn|E209041/sgn|E201199/sgn|E209626/sgn|E203857/sgn|E209556/sgn|E206983/sgn|E202543/sgn|E200970/sgn|E205371/sgn|E201716/sgn|E204264/sgn|E200931/sgn|E205464/sgn|E205760/sgn|E206378/sgn|E310843/sgn|E202375/sgn|E306446/sgn|E204376/sgn|E209603/sgn|E206435/sgn|E204701/sgn|E209109/sgn|E207935/sgn|E208857/sgn|E210570/sgn|E203967/sgn|E209448/sgn|E207102/sgn|E202648/sgn|E208854/sgn|E202424/sgn|E207098/sgn|E215

 

1506

 

3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B) , complete

 

1377

 

2529

 

0

 

1276

 

100

 

1506

 

3)-beta-glucanase isoenzyme GV) (Beta-1,3- endoglucanase GV).

 

318

 

288

 

7.00E-78

 

316

 

48

 

1506

 

3)-beta-glucan endohydrolase B) ((1->3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B)

 

360

 

679

 

0

 

360

 

93

 

1506

 

SGN-U312944

 

1508

 

2769

 

0

 

1397

 

100

 

1506

 

3)-beta-glucanase B) (Basic beta-1,3-glucanase) (Beta-1,3-endoglucanase B) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

360

 

679

 

0

 

360

 

93

 

1506

 

AT3G57270.1 | Symbol: None | glycosyl hydrolase family 17 protein, similar to beta-1,3-glucanase GI:16903144 from (Prunus persica) | chr3:21202216-21204168 REVERSE | Aliases: F28O9.120

 

340

 

325

 

3.00E-89

 

324

 

51

 

CCTAACTAGCTATATGTTCTTCCTTTTTTTTTTCAAGTCAAAGTTATACATCATCAAATTCATCTTCTTTTTTCCACAAAAATAAATAAATAAAATAATCAAGTTGATCAAGTCACCTGGCGGCTCTTAACAAATTCTAATAATATTCCACTTCAATTAATATCATACACAAGTCTATCTCAGTGTAGTTATAAATAGCTCTTAATCCATCTTAGTTTGTACCAAAAACATTACTTCTCATCAAACATCATGGCTACCTCACAAATAGCTATTATTGTGCTTCTAGGATTACTTGTCGCCACCAACATTCACATAACAGAGGCTCAAATAGGTGTTTGTTATGGAATGATGGGGAACAACTTGCCATCACATTCTGAAGTTATACAGCTCTACAAGTCGAGAAACATTAGAAGACTGAGGCTTTATGATCCAAATCATGGAGCTTTGAATGCGCTAAGAGGATCAAACATTGAAGTGATATTAGGACTTCCAAATGTAGATGTGAAACACATTTCTTCTGGGATGGAACACGCGAGATGGTGGGTACAGAAGAACGTTAGAGATTTCTGGCCTCATGTTAAAATTAAGTATATAGCTGTTGGTAATGAAATCAGCCCTGTTACTGGCACTTCCAATCTTGCCCCATTTCAAGTTCCTGCTTTGGTTAACATTTACAAAGCAATCGGTGAAGCTGGTTTGGGAAATGACATTAAGGTCTCAACGTCTGTAGACATGACGTTGATTGGCAATTCTTATCCACCATCACAGGGTTCATTTAGGAACGATGTTAGATGGTTTACTGATCCAATTGTTGGGTTTTTGAGGGATACACGTGCACCTTTGCTCGTTAACATTTATCCTTATTTTAGCTATTCTGGTAATCCAGGACAGATTTCACTTCCGTATGCTCTTTTTACAGCACCTAATGTAGTGGTACAAGATGGATCGCGTCAATATAGGAACTTATTTGATGCTATGTTGGATTCTGTTTATGCTGCGATGGATCGAACAGGAGGAGGATCTGTAGGAATAGTTGTGTCAGAGAGTGGATGGCCATCTGCTGGTGCATTTGGTGCAACACATGAAAATGCACAAACATACTTGAGGAACTTAATTCAACATGCTAAAGAAGGTAGTCCGAGAAAGCCTGGACCTATAGAGACTTATATATTCGCCATGTTTGATGAGAATAACAAGAATCCAGAGCTTGAGAAGCATTTTGGAATGTTTTCACCAAACAAGCAGCCAAAATACAACCTAAACTTTGGGGTGTCTGAAAGAGTTTGGGACATTACTAATAGCACTGCTTCTTCACTCACTAGTGAGATTTAAAAAGACATATTTGAAAGCATATATATAGTATCTTCATGCAATTTTATGTTTGTATGCAACACCAAATAAATTCGTAGGGGGAACTTTTAAAATTCCTTTTGTTTGTCATTCTGGAATGAAACTTTTTGTAAGGTTGTATATTTCAATACACCATCAATTACATTAAAAAAAAAA

 

1506

 

39493

 

Contig16097

sgn|E245253/sgn|E245256/sgn|E318470/sgn|E231465/LEFL1060BH01/sgn|E354810

1135

4)-beta-D-galactanase) , complete

3229

Show
Contig16097

Contig16097

 

sgn|E245253/sgn|E245256/sgn|E318470/sgn|E231465/LEFL1060BH01/sgn|E354810

 

1135

 

4)-beta-D-galactanase) , complete

 

3229

 

2198

 

0

 

1109

 

100

 

1135

 

4)-beta-D-galactanase).

 

827

 

337

 

9.00E-93

 

225

 

65

 

1135

 

4)-beta-D-galactanase)

 

835

 

504

 

1.00E-141

 

231

 

100

 

1135

 

SGN-U312680

 

3251

 

2198

 

0

 

1109

 

100

 

1135

 

4)-beta-D-galactanase) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

835

 

504

 

1.00E-142

 

231

 

100

 

1135

 

AT3G13750.1 | Symbol: None | beta-galactosidase, putative / lactase, putative, similar to beta-galactosidase precursor SP:P48980 from (Lycopersicon esculentum) | chr3:4510985-4516305 FORWARD | Aliases: MMM17.1

 

847

 

384

 

1.00E-107

 

231

 

73

 

AGGCTCTTTAGTGGCTCAGAAGCAGCCACTCAGTTGGTATAAGACTACATTCAATGCTCCAGATGGAAATGAACCTTTGGCTTTAGATATGAATACCATGGGCAAAGGTCAAGTATGGATAAATGGTCAGAGCCTCGGACGCCACTGGCCTGCATATAAATCATCTGGAAGTTGTAGTGTCTGTAACTATACTGGCTGGTTTGATGAGAAAAAGTGCCTAACTAACTGTGGTGAGGGCTCACAAAGATGGTACCACGTACCCCGGTCTTGGCTGTATCCTACTGGAAATTTGTTAGTTGTATTCGAGGAATGGGGAGGAGATCCTTATGGAATCACTTTAGTCAAAAGAGAAATAGGGAGTGTTTGTGCTGATATATATGAGTGGCAACCACAGTTATTGAATTGGCAGAGGCTAGTATCTGGTAAGTTTGACAGACCTCTCAGACCTAAAGCCCATCTTAAGTGTGCACCTGGTCAGAAGATTTCTTCAATCAAATTTGCAAGCTTTGGAACACCAGAGGGAGTTTGTGGGAACTTCCAGCAGGGAAGCTGCCATGCTCCGCGCTCATATGATGCTTTCAAAAAGAATTGTGTTGGGAAAGAGTCTTGCTCAGTACAGGTAACACCAGAGAATTTTGGAGGTGATCCATGTCGAAACGTTCTAAAGAAACTCTCAGTGGAAGCCATTTGTAGTTGATGATTCTGAGTATACAAGTGAAAAAATACTTGAACCACTCATATAAACATTTTTCAAACGAGCTACTAGACATCCATTAACCCACACTACCATTTTTTGGCTTTGCTGGGGTTGAAGTTGTACAGTTAAGCAACACACCTCTTTGATCAAAGCTCACCTGATTATGAAGATGATTGACGAAAGATTCTGTACATGTAAGGTTTCGTCTAATTACACATACAGATATGATTCTTGATGAATCGATGTGCAAATTTTGTTTGTGTTAGGGTGAGAGAGACTTGAAAAGCATTTTGCTTTCATGATGTTCTACATTATACAATCATAATGTAAGTAAGCAAGCAATAATTCATTGCTTTGCACATTGAAAAATGCATTTTACTATGTTGCAGTACACCATCAAGCTCTTTCAATTAAAAAAAAAAAAAAAAAAAAACTCGA

 

1135

 

38781

 

Contig16257

sgn|E248605/sgn|E209973/sgn|E202325/sgn|E264440

975

4)-beta-D-galactanase) , complete

3229

Show
Contig16257

Contig16257

 

sgn|E248605/sgn|E209973/sgn|E202325/sgn|E264440

 

975

 

4)-beta-D-galactanase) , complete

 

3229

 

1893

 

0

 

971

 

99

 

975

 

4)-beta-D-galactanase).

 

827

 

475

 

1.00E-134

 

323

 

69

 

975

 

4)-beta-D-galactanase)

 

835

 

665

 

0

 

323

 

99

 

975

 

SGN-U312680

 

3251

 

1893

 

0

 

971

 

99

 

975

 

4)-beta-D-galactanase) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

835

 

665

 

0

 

323

 

99

 

975

 

AT3G13750.1 | Symbol: None | beta-galactosidase, putative / lactase, putative, similar to beta-galactosidase precursor SP:P48980 from (Lycopersicon esculentum) | chr3:4510985-4516305 FORWARD | Aliases: MMM17.1

 

847

 

536

 

1.00E-153

 

325

 

77

 

CGCAAGACTTATACAAACGGGGGGCTCCTTCATCAATTACTATATGTATCATGGACGAACAAACTTTGGAAGGACTTCTGGTGGCCCATTTATTGCTACTAGTTATGATTATGATGCACCCCTAGATGAATTTGGGTCATTACGGCAGCCTAAATGGGGTCATCTGAAAGATCTACATAGAGCAATAAAGCTCTGTGAGCCACCTTTAGTATCTGTAGATCCAACTGTGACATCCTTAGGAAACTATCAAGAGGCACGTGTTTTCAAGTCAGAGTCTGGGGCCTGCGCTGCCTTCCTAGCAAATTACAACCAGCACTCTTTTGCTAAAGTGGCATTTGGGAACATGCATTATAACTTGCCACCCTGGTCTATCAGCATTCTTCCCGACTGCAAGAACACTGTCTATAATACTGCAAGGGTTGGTGCTCAAAGTGCTCAGATGAAGATGACTCCAGTCAGTAGAGGATTCTCATGGGAGTCATTCAATGAAGACGCAGCATCGCATGAAGACGACACTTTCACAGTTGTTGGGTTATTGGAGCAGATTAATATCACAAGAGATGTATCTGATTACTTGTGGTATATGACTGACATTGAGATTGATCCAACAGAAGGATTTTTGAATAGTGGAAATTGGCCTTGGCTTACTGTCTTCTCTGCTGGCCATGCATTGCATGTATTCGTGAATGGTCAATTAGCAGGAACTGTGTACGGAAGTTTAGAAAACCCAAAACTAACTTTCAGCAACGGTATAAATCTGAGAGCTGGTGTGAACAAGATTTCTCTGCTAAGCATTGCTGTTGGTCTTCCGAACGTTGGCCCTCATTTTGAGACATGGAATGCTGGTGTTCTTGGACCAGTTTCACTTAATGGACTTAATGAAGGAACAAGAGATTTAACATGGCAGAAATGGTTCTACAAGGTTGGTCTAAAAGGAGAAGCCCTGAGTCTTCATTCACTCAGTGGTAGCCATCC

 

975

 

38941

 

Contig9478

sgn|E320659/LEFL2045N17

677

AA824665 similar to GP|20197166|gb|AAC27402.2 expressed protein {Arabidopsis thaliana}, partial (37%)

560

Show
Contig9478

Contig9478

 

sgn|E320659/LEFL2045N17

 

677

 

AA824665 similar to GP|20197166|gb|AAC27402.2 expressed protein {Arabidopsis thaliana}, partial (37%)

 

560

 

377

 

1.00E-104

 

193

 

99

 

677

 

AK119617|Os07g0660700 WD40-like domain containing protein.

 

353

 

272

 

1.00E-73

 

208

 

59

 

677

 

ref|NP_565782.1| nucleotide binding [Arabidopsis thaliana]

 

353

 

304

 

2.00E-81

 

214

 

67

 

677

 

SGN-U343186

 

1031

 

462

 

1.00E-129

 

329

 

93

 

677

 

Q58DT8|WDR55_BOVIN WD repeat protein 55 - Bos taurus (Bovine)

 

382

 

137

 

5.00E-32

 

202

 

35

 

677

 

AT2G34260.1 | Symbol: None | transducin family protein / WD-40 repeat family protein, similar to Vegetatible incompatibility protein HET-E-1 (SP:Q00808) {Podospora anserina} | chr2:14472928-14475604 FORWARD | Aliases: F13P17.10, F13P17_10

 

353

 

304

 

3.00E-83

 

214

 

67

 

AAGCCTAAACCCTTGTCAGGGAAGTATGGCTGCCGTGGAGATAGACCTTGGAAAGCTTCCATTTGACATTGATTTTCATCCCTCCGATCACCTTGTTGCTGCTGGACTCATCACCGGCGACCTTCTCTTGTACCGTTACAATGCTGATTCTCCGGCTCAGAAGTTGTTGGAAGTAAAAGCTCATAGTGAATCATGTAGAACTGTCCGGATTATCAACGAGGGCCGTGCAATTGTGACGGGATCTCCAGATTGTTCTATTCTTGCAACAGACATTGAGACTGGCTCAGAAATTGTTCGCCTGGAGAATTCCCATGGGGCTGCTGTTAATCGAATTGTTAATTTGACTGAGTCAAGTATTGCTTCCGGAGACGATGAAGGATGCATTAAGGTATGGGATACCAGACAACGCTCATGCTCCCATTCTTTTAATGCACATGAAGAATACATTTCAGACATTACATTTGCAGCTGATTCCATGAAACTATTAGCAACAAGTGGCGATGGGTCACTTTCTGTATGCAATTTAAGGAGCAGTAAGATCCAAACTCGCTCTGAATTTTCTGAAGAGGAGCTGCTCTCTGTGGTAATTATGAAGAATGGTAGAAAAGTAATATGTGGTACTCAATCTGGAACTCTGTTACTGTATTCATGGGGATTTTTCAAGGATTGCAGTGATC

 

677

 

32162

 

Singlet8964

LEFL2001DE12

608

AA824672

358

Show
Singlet8964

Singlet8964

 

LEFL2001DE12

 

608

 

AA824672

 

358

 

274

 

5.00E-73

 

138

 

100

 

608

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

608

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

608

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

608

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

608

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

ACGGATCCCAAGAAACATAACTAAATCCTCTAAAGTACCAACCAACTGGTATTTCATTTCAAATTGAGTTTAGCTCTCTGATTGAGTTTAGCTCTCTGAGGAAAAATTTGATCTTGATTGTGATTCTGGGTTACAAATTGAAAAAAGGGCTGATTTCTTTTTGCATTTTTTGAGCTTTGGAAAATGTTGGGTTTCTACAAATGATTGCGGAAGTGTTAGCTTTGGTTGGTTACAGGGTGGAAAAAGGTGTAGAATTTCTTGAAATTGTGAGGTTATGTTGGGATTGACTTGTCAAGATTGCGGTTGACAATAGGAGTTTTGGGTAATATGTTGGTTTGGGGGTGAATACCTTCTGGAATGTTTGAGAAGATGCTTCCTTTTTTTAAAAAAAAAATAAAATAAAAAATGACACATTTGAAGTTTCTTTTAGTTGACAATAGGAAGAAAGATATTCGGGAATGTTGAATTTGTATCACCTGGAAACTTAGATTTATATATAAGATAAGAATAAGAATCTGTTTTCACATTTGAGCAAGTAGTCTCT

 

544

 

8964

 

Singlet7812

LEFL1070BB01

642

AA824672

358

Show
Singlet7812

Singlet7812

 

LEFL1070BB01

 

642

 

AA824672

 

358

 

238

 

3.00E-62

 

120

 

100

 

642

 

AY344492|Os05g0530400 Heat shock factor protein 1 (HSF 1) (Heat shock transcription factor 1) (HSTF 1).

 

459

 

172

 

2.00E-43

 

103

 

75

 

642

 

dbj|BAA83711.1| heat shock factor [Nicotiana tabacum]

 

408

 

240

 

4.00E-62

 

119

 

91

 

642

 

SGN-U329730

 

2019

 

289

 

1.00E-77

 

360

 

85

 

642

 

O49403|HFA4A_ARATH Heat stress transcription factor A-4a (AtHsfA4a) (Heat shock factor protein 21) (HSF 21) (Heat shock transcription factor 21) (HSTF 21) - Arabidopsis thaliana (Mouse-ear cress)

 

401

 

192

 

1.00E-48

 

117

 

76

 

642

 

AT4G18880.1 | Symbol: None | heat shock transcription factor 21 (HSF21), identical to heat shock transcription factor 21 (Arabidopsis thaliana) GI:3399765: contains Pfam profile: PF00447 HSF-type DNA-binding domain | chr4:10347593-10349573 REVERSE | Aliases: F13C5.50, F13C5_50

 

401

 

192

 

2.00E-49

 

117

 

76

 

CCATTTGAGCAAGTAGTCTCTAGTGTGGGGTTCTGGAAACAAGCATGTAGTCTGTGATCAGGTGAGATTTGCTTGAATTTGATTGTAACGCAGCGAGATCTAGCTCATTACGATCCTTACGAGGAGTTTTCTGGAGTGTGATGATAAGAAGTTTTGCTCTTAGTAGATGTTCTGTTTCGTTGTTTTAGTTTAGGGGTTGTGATTTTCGTTGAAACCTATCATGGATGAAGCTTCGTGCAGCACGAATGCACTGCCTCCTTTTATTGCAAAGACATATGAAATGGTGGATGATCCATCCTGTGATGCTATTGTCTCCTGGAGTTCGAATAATAAAAGCTTCATTGTGTGGAATCCTCCAGATTTTGCAAGAGATTTGTTGCCTAGATACTTCAAGCACAATAATTTTTCCAGCTTTATCAGACAACTAAACACTTATGGATTCAGGAAAATTGACCCTGAAAAATGGGAGTTCGCGAATGAAGGTAATTTCATTAGAGGTCAGCCGAACCTTTTGAAGAATATCCATAGGCGTAAACCTGTTCATAGTCATTCTGCACAGAATCTTCATGGCCTGTCATC

 

579

 

7812

 

Singlet12342

LEFL2049G09

587

AA824672

358

Show
Singlet12342

Singlet12342

 

LEFL2049G09

 

587

 

AA824672

 

358

 

180

 

6.00E-45

 

99

 

98

 

587

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

587

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

587

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

587

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

587

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

AGGATTAATGTTCACTAAGCCCTAGAAAAATTGCACAAATTCCGATGTTTTTTTTTAATAATCCTCACGGATCCCAAGAAACATAACTAAATCCTCTAAAGTACCAACCAACTGGTATTTCATTTCAAATTGAGTTTAGCTCTCTGATTGAGTTTAGCTCTCTGAGGAAAAATTTGATCTTGATTGTGATTCTGGGTTACAAATTGAAAAAAGGGCTGATTTCTTTTTGCATTTTTTGAGCTTTGGAAAATGTTGGGTTTCTACAAATGATTGCGGAAGTGTTAGCTTTGGTTGGTTACAGGGTGGAAAAAGGTGTAGAATTTCTTGAAATTGTGAGGTTATGTTGGGATTGACTTGTCAAGATTGCGGTTGACAATAGGAGTTTTGGGTAATATGTTGGTTTGGGGGTGAATACCTTCTGGAATGTTTGAGAAGATGCTTCCTTTTTTTAAAAAAAAAATAAAATAAAAAATGACACATTTGAAGTTTCTTTTAGTTGACAATAGGAAAAAAGATATTCGGGAATGTTGAATTTGTATCACCTGGAAACTT

 

552

 

12342

 

Singlet11237

LEFL2033N15

588

AA824672

358

Show
Singlet11237

Singlet11237

 

LEFL2033N15

 

588

 

AA824672

 

358

 

180

 

6.00E-45

 

99

 

98

 

588

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

588

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

588

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

588

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

588

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

AGGATTAATGTTCACTAAGCCCTAGAAAAATTGCACAAATTCCGATGTTTTTTTTAATAATCCTCACGGATCCCAAGAAACATAACTAAATCCTCTAAAGTACCAACCAACTGGTATTTCATTTCAAATTGAGTTTAGCTCTCTGATTGAGTTTAGCTCTCTGAGGAAAAATTTGATCTTGATTGTGATTCTGGGTTACAAATTGAAAAAAGGGCTGATTTCTTTTTGCATTTTTTGAGCTTTGGAAAATGTTGGGTTTCTACAAATGATTGCGGAAGTGTTAGCTTTGGTTGGTTACAGGGTGGAAAAAGGTGTAGAATTTCTTGAAATTGTGAGGTTATGTTGGGATTGACTTGTCAAGATTGCGGTTGACAATAGGAGTTTTGGGTAATATGTTGGTTTGGGGGTGAATACCTTCTGGAATGTTTGAGAAGATGCTTCCTTTTTTTAAAAAAAAAATAAAATAAAAAATGACACATTTGAAGTTTCTTTTAGTTGACAATAGGAAGAAAGATATTCGGGAATGTTGAATTTGTATCACCTGGAAACTT

 

551

 

11237