KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Contig10931

sgn|E233014/sgn|E377602/sgn|E350950/sgn|E349661

1087

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

6837

Show
Contig10931

Contig10931

 

sgn|E233014/sgn|E377602/sgn|E350950/sgn|E349661

 

1087

 

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

 

6837

 

1959

 

0

 

1077

 

97

 

1087

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

1087

 

ref|NP_783274.1| Ycf2 [Atropa belladonna]

 

2291

 

690

 

0

 

361

 

93

 

1087

 

SGN-U327458

 

1087

 

2113

 

0

 

1087

 

99

 

1087

 

Q8S8U1|YCF2B_ATRBE Protein ycf2 B - Atropa belladonna (Belladonna) (Deadly nightshade)

 

2291

 

690

 

0

 

361

 

93

 

1087

 

ATCG01280.1 | Symbol: YCF2.2 | hypothetical protein | chrC:145291-152175 REVERSE | Aliases: YCF2.2

 

2294

 

624

 

1.00E-179

 

363

 

86

 

AAAGATCCATTAGATAATGAACTATTGGTTCTAAGCCATCTCTGACGATTAATCAACAATTCGAAGTGCCTTTCTTGCGTATTCTTGATAAACCAGCGTTTATATATAGATGTAGGAGGATCCATTTGGGAAGTAAGAAGCCCCTTTGACATCTCTTCATCTGCAAATAATTCTCGATGTGAAAACACAGAGCCAGGGGGCTGATCTTTGAATAGGAAAAAGAGTGGATCTGCAGGGTCCAAAATGAATTGGCTTATTCGAAAAAGGCCTTGTTCTTTGGAAGATCTATCTCGTGTCTGGTACTGCATGGTTCCACTCTGCAAGAACCCCGAATCAGTCTCTTGAAGCTCATCCTTTTCATCATAAAGGATCCGCTTGCCCCGAAATGACCTGGACCAATAGGGAAATCCCAATTCATTGGGCCTTTCGATACAATCAAATAGAAAGCCCCAAGGGCGCCATATTCTAGGAGCCCAAACTATGTGATTGAATAAATCCTCCTGCGGGTCAAGGGCTCCTTCTCCCTCCCCTTCTTCAAACTCCGATTCATATTTTTCATAGAGAAATCTCTGATCAAGGATAGACCAAGAGCCCTTTTGCATCATATCTAAGGGATTCCTCGGTTCGGGCCGAAGAAGCAATGTCACTCGATCATTATCAAACTGACTGCAATCTTTTTCTGTCCGTGAAGATCCCACCAGAGCGCCCTCTACTTCTAATAGGCCATGAACTAGATCAGAATCATTCTCAACGAGTCCATAAGAAGTGATCCCATTTTTTTCATCGGGTACGGATAAAGACCAAAGATCTTGAGCGACCGATCCGGCAGAACAACTCAAAAGATAAAGAAGTATCGTTAATCTCTTCATGCTCGTTCCAAGCTCGAAGTACCATTTGTACAAATAAGAATCCCCTTCGTTACATGATTTCTTCTTCATATAGATAGATATAGGATCTATGGGGCAATTACTTAGAAGTACATTTTGTGCTACAGCCCTTCCTATCTGATAGAAAAAGATCCCATGATCCTGAACCGATCTTACCTGGGATCGCAAATCCCAAGTTTGTCTATGAAGAAGCGATCTAA

 

1087

 

33615

 

Contig11934

sgn|E392483/sgn|E349529/sgn|E354111

877

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

6837

Show
Contig11934

Contig11934

 

sgn|E392483/sgn|E349529/sgn|E354111

 

877

 

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

 

6837

 

1671

 

0

 

851

 

99

 

877

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

877

 

gb|ABB90081.1| Ycf2 [Solanum tuberosum]

 

2278

 

565

 

1.00E-160

 

275

 

100

 

877

 

SGN-U329401

 

877

 

1697

 

0

 

877

 

99

 

877

 

Q27RY7|YCF2_SOLTU Protein ycf2 - Solanum tuberosum (Potato)

 

2278

 

565

 

1.00E-161

 

275

 

100

 

877

 

ATCG01280.1 | Symbol: YCF2.2 | hypothetical protein | chrC:145291-152175 REVERSE | Aliases: YCF2.2

 

2294

 

491

 

1.00E-139

 

277

 

88

 

GCGATTGGGTACGGGCCCCCCCTCGAGAACAAGTGGGCTATTTCTTTGCAAACTGTGCTCAATTTCATATGTGGCAATTCCGCCAAGATCTCTTCGTTAGTTGGGGGAAGAATCCGCCCGAATCGGATTTTTTGAGGAACGTATCGAGAGAGAATTGGATTTGGTTAGACAATGTGTGGTTGGTAAACAAGGATCGGTTTTTTAGCAAGGTACAGAATGTATCGTCAAATATTCAATATGATTCCACAAGATCTAGTTTCGTTCAAGTAACGGATTCTAGCCAACTGAAAGGATCTTCTGATCAATCCAGAGATCATTTGGATTCCATTAGTAATGAGGATTCGGAATATCACACATTGATTAATCAAAGAGAGATTCAACAACGAAAAGAAAGATCGATTCTTTGGGATCCTTCCTTTCTTCAAACGGAACGAAAAGAGATAGAATCAGGCCGATTCCCGAAATGCCTTTCTGGATATTCCTCAATGTCCCGGCTATTCACGGAACGTGAGAAGCAGATGATTAATCATCTGTTTCCGGAAGAAATCGAAGAATTTCTTGGGAATCCTACAAGATCCGTTCGTTCTTTTTTCTCTGATAGATGGTCAGAACTTCATCTGGGTTCGAATCCTACTGAGAGGTCCACTAGAGATCAGAAATTGTTGAAGAAACAACAAGATCTTTCTTTTGTCCCTTCCAGGCGATCGGAAAAGAAAGAAATGGTTAATATATTCAAGATAATTACGTATTTACAAAATACCGTCTCAATTCATCCTATTTCATCAGATCCGGGATGTGATATGGTTCCGAAGGATGAACCGGATATGGACAGTTCCAATAAGATTTCATTCTTGAACAAAAATCCATTTTTTGATTT

 

877

 

34618

 

Contig8251

LEFL2027O10/LEFL2024N15/LEFL2049C07/LEFL2055C19/LEFL2026H10/LEFL2044L05/sgn|E537998/sgn|E378122

693

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

6837

Show
Contig8251

Contig8251

 

LEFL2027O10/LEFL2024N15/LEFL2049C07/LEFL2055C19/LEFL2026H10/LEFL2044L05/sgn|E537998/sgn|E378122

 

693

 

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

 

6837

 

1277

 

0

 

680

 

98

 

693

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

693

 

ref|YP_514895.1| Ycf2 protein [Lycopersicon esculentum]

 

2278

 

447

 

1.00E-124

 

226

 

100

 

693

 

SGN-U332394

 

688

 

1261

 

0

 

680

 

98

 

693

 

P61242|YCF2_SOLLC Protein ycf2 - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

2278

 

447

 

1.00E-125

 

226

 

100

 

693

 

ATCG01280.1 | Symbol: YCF2.2 | hypothetical protein | chrC:145291-152175 REVERSE | Aliases: YCF2.2

 

2294

 

378

 

1.00E-105

 

231

 

87

 

TAGCGAGTCGAGGTCGAGTAAGTGTTTACATAATCTTCTTCTGTCCGAAGAAATGATTCATCGAAATAATGAGTCACCATTGATATCGACACATCTGAGATCGCCAAATGCTCGGGAGTTCCTCTATTCAATCCTTTTCCTTCTTCTTGTTGCTGGATATCTCGTTCGTACACATCTTCTCTTTGTTTCCCGGGCCTCTAGTGAGTTACAGACAGAGTTCGAAAGGGTAAAATCTTTGATGACTCCATCATCTATGATTGAGTTGCGAAAACTTCTGGATAGGTATCCTACATCTGAACCGAATTCTTTCTGGTTAAAGAATCTCTTTCTAGTTGCTCTGGAACAATTAGGAGATTCTCTAGAAGAAATACGGGGTTCTGCTTCTGGCGGCAACATGCTTGGTCCCGCTTATGGGGTCAAATCAATACGTTCTAAGAAGAAAGATTGGAATATCAATCTCATCGAGATCATCGATCTCATACCAAATCCCATCAATCGAATCACTTTTTCGAGAAATACGAGACATCTAAGTCATACAAGTAAAGAGATCTATTCATTGATAAGAAAAAGAAAAAACGTGAACGGGGATTGGATTGATGAGAAAATAGAATCCTGGGTCGCGAACAGTGATTCGATTGATGATGAAGAAAGAGAATTCTTGGTTCAGTTCTCCACCTTAACGACAGAAAATAG

 

693

 

30935

 

Contig8959

LEFL2051N24/LEFL2048E19/LEFL2036E12/LEFL2039A02

706

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

6837

Show
Contig8959

Contig8959

 

LEFL2051N24/LEFL2048E19/LEFL2036E12/LEFL2039A02

 

706

 

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

 

6837

 

1346

 

0

 

679

 

100

 

706

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

706

 

ref|YP_514895.1| Ycf2 protein [Lycopersicon esculentum]

 

2278

 

480

 

1.00E-134

 

231

 

99

 

706

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

706

 

P61242|YCF2_SOLLC Protein ycf2 - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

2278

 

480

 

1.00E-135

 

231

 

99

 

706

 

ATCG01280.1 | Symbol: YCF2.2 | hypothetical protein | chrC:145291-152175 REVERSE | Aliases: YCF2.2

 

2294

 

397

 

1.00E-111

 

235

 

86

 

TAGCGAGTCGAGGTCGAGATCTCACTTATCAGATTCCATTGTGGAAGACACAATTTTTTCTGAAGAATTCGCCATGATATACCTGATCCATGCATAATATCAGGAAAAATGGATACAAATTTTTGACTGCTACTTAGTATTGGCAATAGGTCTGAAAAAGTATCTAAAAATATCAAATTTAGATATTTGTACCCTGTCGAAGTAAGGAACCATGGCATATATGTTTGGAATAGATTCCATTTTGAGAGAGTTGAAAAAGCACTATCTCGTTGAAAGGTTCTATACGTCTGCCCTTTCTCAACGCATTTCTTTAGACAAAGACTCCATTTTTTCCTCTTTTCGGATGATAAATCTTTCTCAGAACATGGAGTGTGAATCAAACCCATGTTTGAATTGAAATTGAGATACTGATGCAAGTTCTTCCCTTCTGAATCAGATAGATTCATATCTGAAAGAGGTTGACAATAAGTTCTTTCAAAATTGACTATTTGCCCCTCTGTTAGAGGTGTTCCAGAAATGTCTGCGATCGAGTAAATAGCTCTACGAACGAATGGATCGGATCGACTTGGAAAATGGAAAGATTTGTACAAGTTATACGTTTCGTCACCACTTTGTGGAAAATCGTTAGGTATGAATATGTTAGATACCTGTGACTCGATTGGTGAAATAGTATCTCTCCCCCAAAAAGCATGTTTTTTTTTACCGA

 

706

 

31643

 

Singlet9443

LEFL2009A21

777

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

6837

Show
Singlet9443

Singlet9443

 

LEFL2009A21

 

777

 

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

 

6837

 

289

 

1.00E-77

 

286

 

88

 

777

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

777

 

ref|YP_762304.1| hypothetical chloroplast RF2 [Morus indica]

 

2292

 

71

 

5.00E-23

 

43

 

81

 

777

 

SGN-U329401

 

877

 

274

 

8.00E-73

 

286

 

87

 

777

 

P09976|YCF2_TOBAC Protein ycf2 - Nicotiana tabacum (Common tobacco)

 

2280

 

79

 

1.00E-14

 

64

 

67

 

777

 

ATCG01280.1 | Symbol: YCF2.2 | hypothetical protein | chrC:145291-152175 REVERSE | Aliases: YCF2.2

 

2294

 

67

 

1.00E-11

 

62

 

61

 

GAGGATTGTGGATAATATTCCTTTTGTTTTAATGCAAAGGATAAGTTATATCTTTTAACTCTCCGTAATTCATCTATGTGAACATTGCTAAGTTGTTAATATATGTGAAATAGGAAAGTTACTTCCTCAATAATGTCTCACATTTATTTCAAGTGTAAGTTTCTCAACTTCGTAAGAAATATTCAGAAGACTTGAAGTTACTCTTGTATTATGATAAATTTGTCATTAAAGTAAGAGTTATGTTTCATTACATTAATTATACGTTAGTTTCTTACATTCTTTTGATGCATGAAACATAAATGATTTTCCTATTTAAGGAGTATCATTTTGGGAGCTAAACACAGAGAAGAAGAAAAAGTCTATCTTTCATTTTCTCTCCCTCAATAATTTCCTTTATTGGTAAATGATCTCTGGATTGATCAGTAGATCCTTTCAGTTGGCTAGAATCAGTTACTTGAACGAAACTAGATCTTGTGGAATCATATTGAAAATTTGACAATACATTCTGTACCTTGCTAAAAAAACTGATTTTTATTTACCAAACACATTGTCTAACCAAATCAAATTCTTTTTCGATACGTTTCTCAAAAAATTTGATTTGGACGGATTCTTCACCTAGCTAACGAAGAATCTTTGCGGAATCGCTACATATGAAATTGAGCACAATTTTGTAAAGAAATAGCCGCCATCCATATCCCAATTCCATTAATTTAATATGTCATTTCTAGTCTATCTCTTTC

 

740

 

9443

 

Contig11933

sgn|E228065/sgn|E392241/sgn|E235531/sgn|E233596/sgn|E214349/sgn|E550053/sgn|E389903

1343

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

6837

Show
Contig11933

Contig11933

 

sgn|E228065/sgn|E392241/sgn|E235531/sgn|E233596/sgn|E214349/sgn|E550053/sgn|E389903

 

1343

 

TC169810 UP|YCF2_LYCES (P61242) Protein ycf2, complete

 

6837

 

2551

 

0

 

1345

 

98

 

1343

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

1343

 

ref|YP_514895.1| Ycf2 protein [Lycopersicon esculentum]

 

2278

 

831

 

0

 

444

 

92

 

1343

 

SGN-U322548

 

1343

 

2579

 

0

 

1343

 

98

 

1343

 

P61242|YCF2_SOLLC Protein ycf2 - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

2278

 

831

 

0

 

444

 

92

 

1343

 

ATCG01280.1 | Symbol: YCF2.2 | hypothetical protein | chrC:145291-152175 REVERSE | Aliases: YCF2.2

 

2294

 

680

 

0

 

458

 

78

 

GAAGTGATGTGGATTATTCAAGAATCGAAGTCGATTTGCTTTATAAAAAGAAGATATCAATGAACTTCTATGAAATGGTTTCACGGGATTCAGCCAATTGTCTTGATCGTGGAATATCATTGAGAAATAGGAATCCGGGTTATCAAAGGATTTCCTGCGATTATTTCTAGTATGGAATGAGTCAATCATCCACTTTGGTATCTTATTGAACAAAAATGGTGATATTGTTCCTCCATTGATCAAGAATTTCGATTTTTGGGAAGTATCATGATCGTCCAATAAGAAGGGTTTCAATTTTTTCAAATGAACAATTTGAAGACCTATTGATTCTAACAACTGATTGCAGAGTTGATCATTCGGACCTTTCAATTCTTCATAGATGTAGATCTCGGACCTATGAATGGGGATATTTCCGAAACTCACACAGAAAAAAGGAAGTGAGTTAGACAAAAATAAAAGCAACTTGGACAAAAAAAGAAGTGACTTGGACAAAAAGAAACGAAGTGACTTAGACAAATCTTTTTTGTCGATAACCTCAGACCAATCAATCGAATATTGATTAATACGTAATCGATCGAACACTACTTGAAAACGGCTCTTCTGCTTCGAAACGGACTGTTCCAAATGTTCCTGGAAACTCTTGCTCCCATTGGACCATTTGTATCTATATGCATCAGGATCCCGATTCATGGATCTCTCGGTTCGAGAAATCAAAATAAGAGGCTCGAACCATTTCTTCTGACTCTTTTTCAAATTCGATAAATATTGGTTGATCGTATATTTCATTATAGTTCTATGATTCAGAGTATCCTTTCCTATTTGATCCCTTTGAATTCCATATTCGAAGTTGCGATCGGATCTATTCATTAAAAAGAATCGATTCAATACATTTCTTATGTACCCATAGGTACTATATTGGATTTGAATCAGATTTCGGATCAATCTATATTGAGTGACTGCCTCCATTATGTTGTTGCTAGCAAATACCACTATTTTTGGTTTTGGATCTTCCAAATCATTCCCGCAGGAGATCCTGACCCATTTTTTTCTGATCCTTCGAGAAAAAGATTCATTCTCTTCATAAAAAATAGGAGGTAGAACCAATAAAGATTTCTTTTTCGATTCATCCCTGGCCTCATTCAAGAATTGTTTTTGATCCAATCCGCAGGAATCAATAGAAAAGGCAAATCCCTTATGATACACCAGATCCGGCTCGGTTATTGATAGAGTGAATAGATCTGCCATTTCTTGAAATCTCTCTTCTGATGCAAAATCGTAGTGTAACGTGTATCCTCCCCTGTTCCGGTCATGGAATAGATGAAATAATCAAAAATGGATTTTTG

 

1343

 

34617

 

Contig10065

FC04CC08/sgn|E578164

742

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

5748

Show
Contig10065

Contig10065

 

FC04CC08/sgn|E578164

 

742

 

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

 

5748

 

1031

 

0

 

541

 

98

 

742

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

742

 

ref|YP_514911.1| ycf1 protein [Lycopersicon esculentum]

 

1891

 

521

 

1.00E-147

 

247

 

100

 

742

 

SGN-U341756

 

805

 

1031

 

0

 

541

 

98

 

742

 

Q2MI42|YCF1_SOLLC Putative membrane protein ycf1 (RF1) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

1891

 

521

 

1.00E-148

 

247

 

100

 

742

 

ATCG01130.1 | Symbol: YCF1.2 | hypothetical protein | chrC:123884-129244 REVERSE | Aliases: YCF1.2

 

1786

 

142

 

3.00E-34

 

238

 

39

 

AGGGTTAATCAAAGTTGTATGGCTCAAAATAAAAATAGAAACTTAAACAAATGGAATTCATATGAAAAAGACCAATTACTTCATTACAAAAAAGAAAATGATTCGGAACTCTATTCATTATCAAACGAAAAAGATAATTTTAAAAAATGTTATGGATATGGTCTTTTAGCATATAAATCGATTAATTATGAAAATAAAAGTGACTCATTTTTTTCTAGATTACCCTTTGAAGTTCAAGTAAAGAAGAACTTAGAAATTTCGTATAATTCCAACACGTCCAAACACAACTTTGTTGATATGCCCGGCAATCTTCATATCAATAATTATCTAAGAAAGGGCAATATTCTAGATAGAGAAAGAAATCTCGATAGAAAATATTTTGATTGGAAAATTATCCATTTTTCTCTTAGACAAAAAGGAGATATTGAAGCCTGGGTTAAGATCGATACCAACAGTAATCCAAATACTAAAATTGGTATTAATAATTATCAAATAATTGATAAAATTGAGAAAAAGGGGGTTTTTTATCTTACAACTCATCAAAATCCAGAAAAAACTCAAAAAAATTCGAAAAAATTCTTTTTTGATTGGATGGGAATGAATGAAAAAATATTTAATCGTCCCATATTGAATCTGGAATTTTGGTTCTTCCCAGAATTTGTACTACTTTATAATGTCTATAAAATAAAACCGTGGATTATACCAAGCAAATTCCTTCTTTTTAATTTGAATACAAATAAAA

 

742

 

32749

 

Singlet9878

LEFL2014K08

647

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

5748

Show
Singlet9878

Singlet9878

 

LEFL2014K08

 

647

 

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

 

5748

 

236

 

1.00E-61

 

123

 

99

 

647

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

647

 

ref|YP_514911.1| ycf1 protein [Lycopersicon esculentum]

 

1891

 

355

 

9.00E-97

 

211

 

87

 

647

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

647

 

Q2MI42|YCF1_SOLLC Putative membrane protein ycf1 (RF1) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

1891

 

355

 

7.00E-98

 

211

 

87

 

647

 

ATCG01130.1 | Symbol: YCF1.2 | hypothetical protein | chrC:123884-129244 REVERSE | Aliases: YCF1.2

 

1786

 

146

 

1.00E-35

 

211

 

45

 

TAGCGAGTCGAGGTCGAGTATTTCTGCTTTTTAATATTTGGAAAATTTTTTTTGGCGATTCGAATTTTTTAATATTATTTGTTTTATTAGGATTAATGTCTATTTCTGGAGTTACTTTCTTTTTCTCTTTTGTAATTCTTTCTATTTTATTTTTGATTGTACTTGTTCTATCAGTCAAATCCTTCATTTTTGTTTCTATCAGTGAAGAATTTGGCCAATTTCCAGATTCAATTTGACGAAATGATTCGTTAATTATTTGATTACTAATTAGATAATCTTTTTCTTTTTTTGTTTCATTGGATTCAGATATTTCTTTGAATCTAAATAATACAATTAGATTTACTTTTGAAAGTTCTTTTTTTATTTTTTTTAGAAATCCAATACTTTTGATAAACAATTTTGTGGTTTCTTTTGAAACTTTTCTAAATAATTTTGTTTTTCCTTTTAAAATTTTTAGAGTTAGAAAATATTTCTTTTTGAATTTTCCAATTTTTTTTTCGAGTTCCTTAAAAATGGGCTCAAAAAATGAAGGTCGCTTTCGGGGAGAACCAAAGGGAAGTTCAGCTTCCATTCCCCAAACTGTTAAAAAACAAAAATCATCTTTTTGTTTTTGCTTTTTCATTAGCTCTCTGCGGGAGGGGTACAGT

 

647

 

9878

 

Singlet12972

sgn|E578387

726

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

5748

Show
Singlet12972

Singlet12972

 

sgn|E578387

 

726

 

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

 

5748

 

1394

 

0

 

726

 

99

 

726

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

726

 

ref|YP_514911.1| ycf1 protein [Lycopersicon esculentum]

 

1891

 

420

 

1.00E-116

 

241

 

85

 

726

 

SGN-U344530

 

916

 

1433

 

0

 

726

 

100

 

726

 

Q2MI42|YCF1_SOLLC Putative membrane protein ycf1 (RF1) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

1891

 

420

 

1.00E-117

 

241

 

85

 

726

 

ATCG01130.1 | Symbol: YCF1.2 | hypothetical protein | chrC:123884-129244 REVERSE | Aliases: YCF1.2

 

1786

 

236

 

1.00E-62

 

251

 

55

 

TAACAAGTGGTTTTGTTGGTTGGTTAATTGGTCACATTTTATTCATGAAATGGCTTGGATTGGTATTAGTCTGGATACGGCAAAATCATTCTATTAGATCGAATAAGTACATTCGATCTAATAAGTACCTTGTATTAGAATTGAGAAATTCTATGGCTCGGATCTTTAGTATTCTCTTATTTATTACCTGTGTCTACTATTTAGGCAGAATACCCTCACCCATTCTTACTAAGAAACTGAAAGAAGCCTCAGAAACAGAAGAAAGGGTGGAAAGTGAGGAAGAAAGAGATGTAGAAATTGAAACTGCTTCCGAAATGAAGGGGACTAAACAGGAACAAGAGGGATCCACTGAAGAAGATCCTTATCCTTCTCCTTCCCTTTTTTCGGAAGAAGGGTGGGATCCGGACAAAATCGATGAAACGGAAGAAATCCGAGTGAATGGAAAGGACAAAATAAAGGATAAATTCCACTCTCACCTTACAGAGACAGGCTATAACAATATTAATACTAGTAATAGTCCAATTTATGATTATCAGGATTCTTATCTGAATAATAATAACACGGGGAATCTAGAAAATTGTAGATTGCAACTGCTTGATAAAGAAAATGAAAATCAAGAACAAGACCTCTTCTGGTTTCAAAAACCTCTTGTGAGTNCTCTTTTCGAGTATAATCGATGGAATCGACCATTTCGTTACATAAAGAATAATCGATTTGAGCAGGCCG

 

726

 

12972

 

Singlet10281

LEFL2020K10

623

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

5748

Show
Singlet10281

Singlet10281

 

LEFL2020K10

 

623

 

TC169811 UP|Q2A7B0_LYCES (Q2A7B0) Ycf1 protein, complete

 

5748

 

236

 

1.00E-61

 

123

 

99

 

623

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

623

 

ref|YP_514911.1| ycf1 protein [Lycopersicon esculentum]

 

1891

 

339

 

5.00E-92

 

203

 

87

 

623

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

623

 

Q2MI42|YCF1_SOLLC Putative membrane protein ycf1 (RF1) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

1891

 

339

 

4.00E-93

 

203

 

87

 

623

 

ATCG01130.1 | Symbol: YCF1.2 | hypothetical protein | chrC:123884-129244 REVERSE | Aliases: YCF1.2

 

1786

 

145

 

2.00E-35

 

202

 

45

 

TAGCGAGTCGAGGTCGAGTATTTCTGCTTTTTAATATTTGGAAAATTTTTTTTGGCGATTCGAATTTTTTAATATTATTTGTTTTATTAGGATTAATGTCTATTTCTGGAGTTACTTTCTTTTTCTCTTTTGTAATTCTTTCTATTTTATTTTTGATTGTACTTGTTCTATCAGTCAAATCCTTCATTTTTGTTTCTATCAGTGAAGAATTTGGCCAATTTCCAGATTCAATTTGACGAAATGATTCGTTAATTATTTGATTACTAATTAGATAATCTTTTTCTTTTTTTGTTTCATTGGATTCAGATATTTCTTTGAATCTAAATAATACAATTAGATTTACTTTTGAAAGTTCTTTTTTTATTTTTTTTAGAAATCCAATACTTTTGATAAACAATTTTGTGGTTTCTTTTGAAACTTTTCTAAATAATTTTGTTTTTCCTTTTAAAATTTTTAGAGTTAGAAAATATTTCTTTTTGAATTTTCCAATTTTTTTTTCGAGTTCCTTAAAAATGGGCTCAAAAAATGAAGGTCGCTTTCGGGGAGAACCAAAGGGAAGTTCAGCTTCCATTCCCCAAACTGTTAAAAAACAAAAATCATCTTTTTGTTTTTGCTTTTTCATT

 

623

 

10281

 

Contig20366

sgn|E328649/sgn|E328738/sgn|E347693

792

TC169812 UP|Q9LLD0_LYCES (Q9LLD0) Prf, complete

5656

Show
Contig20366

Contig20366

 

sgn|E328649/sgn|E328738/sgn|E347693

 

792

 

TC169812 UP|Q9LLD0_LYCES (Q9LLD0) Prf, complete

 

5656

 

1554

 

0

 

792

 

99

 

792

 

Os11g0229300|Os11g0229300 NBS-LRR disease resistance protein homologue.

 

490

 

81

 

1.00E-15

 

254

 

27

 

792

 

gb|AAC49408.1| PRF

 

1824

 

523

 

1.00E-147

 

264

 

97

 

792

 

SGN-U329801

 

792

 

1570

 

0

 

792

 

100

 

792

 

Q6L403|R1B17_SOLDE Putative late blight resistance protein homolog R1B-17 - Solanum demissum (Wild potato)

 

1312

 

163

 

6.00E-40

 

254

 

41

 

792

 

AT1G58410.1 | Symbol: None | disease resistance protein (CC-NBS-LRR class), putative, domain signature CC-NBS-LRR exists, suggestive of a disease resistance protein. | chr1:21704850-21707920 REVERSE | Aliases: F9K23.6, F9K23_6

 

899

 

85

 

4.00E-17

 

253

 

29

 

AACAACGAAAATGGACAAGAAGATACCGCACAAGGTTTCTTGGACGATCTTATTGGTAGGAATCTGGTGATGGCCATGGAGAAGAGACCTAATGCCAAGGTGAAAACGTGCCGCATTCATGATTTGTTGCATAAATTCTGCATGGAAAAGGCCAAACAAGAGGATTTCCTTCTCCAGATCAATAGTGGAGAAGGTGTATTTCCTGAACGATTGGAAGAATACCGATTGTTCGTTCATTCTTACCAAGATGAAATTGATCTGTGGCGCCCATCTCGCTCTAATGTCCGCTCTTTACTATTCAATGCAATTGATCCAGATAACTTGTTATGGCCGCGTGATATCTCCTTCATTTTTGAGAGCTTCAAGCTTGTTAAAGTGTTGGATTTGGAATCATTCAACATTGGTGGTACTTTTCCCACTGAAATACAATATCTAATTCAGATGAAGTACTTTGCGGCCCAAACTGATGCAAATTCAATTCCTTCATCTATAGCTAAGCTTGAAAATCTTGAGACTTTTGTCGTAAGAGGATTGGGAGGAGAGATGATATTACCTTGTTCACTTCTGAAGATGGTGAAATTGAGGCATATACATGTAAATGATCGGGTTTCTTTTGGTTTGCATGAGAACATGGATGTTTTAACTGGTAACTCACAATTATCTAATTTGGAAACCTTTTCTACTCCGCGTCTCTTTTATGGTAAAGACGCAGAGAAGATTTTGAGGAAGATGCCAAAATTGAGAAATTTGAGTTGCATATTTTCAGGGACATTTGGTTATTCAAGGAAATTG

 

792

 

43050

 

Singlet553

FA21DG02

532

TC169812 UP|Q9LLD0_LYCES (Q9LLD0) Prf, complete

5656

Show
Singlet553

Singlet553

 

FA21DG02

 

532

 

TC169812 UP|Q9LLD0_LYCES (Q9LLD0) Prf, complete

 

5656

 

961

 

0

 

485

 

100

 

532

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

532

 

gb|AAC49408.1| PRF

 

1824

 

195

 

1.00E-48

 

91

 

100

 

532

 

SGN-U344135

 

1171

 

961

 

0

 

485

 

100

 

532

 

Q6L3L0|R1B23_SOLDE Putative late blight resistance protein homolog R1B-23 - Solanum demissum (Wild potato)

 

1262

 

69

 

7.00E-12

 

76

 

43

 

532

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

AGAGTTCCTAGAACTCAAATACTTAAAACTGGACAACCTCAAAGTTGTACAATGGTCCATCTCTGATGATGCTTTTCCTAAGCTTGAACATTTGGTTTTAACGAAATGTAAGCATCTTGAGAAAATCCCTTCTCGTTTTGAAGATGCTGTTTGCCTAAATAGAGTTGAGGTGAACTGGTGCAACTGGAATGTTGCCAATTCAGCCCAAGATATTCAAACTATGCAACATGAAGTTATAGCAAATGATTCATTCACAGTTACTATACAGCCTCCAGATTGGTCTAAAGAACAGCCCCTTGACTCTTAGCAAAGAGGTAGCAGCAGCTAAAGTTCAAGGCATTTTGTTTATTTCTAGAACAAGGGGAGTTCTTACGTTGAATTCTTGAAAAGAAGAAGAATCAGGAGCAGAGTATATATGACGCGAGAATACTTGGCCTAAAAGTTTTTGCTTCACTAATTTAACTATTGCCGTGGATGAAACAAGC

 

485

 

553

 

Contig16428

sgn|E255034/sgn|E270788/sgn|E371105/sgn|E310414

1153

TC173291 UP|O49889_LYCES (O49889) DNA (Cytosine-5)-methyltransferase , complete

5379

Show
Contig16428

Contig16428

 

sgn|E255034/sgn|E270788/sgn|E371105/sgn|E310414

 

1153

 

TC173291 UP|O49889_LYCES (O49889) DNA (Cytosine-5)-methyltransferase , complete

 

5379

 

2276

 

0

 

1148

 

100

 

1153

 

AK111461|Os07g0182900 Cytosine-5 DNA methyltransferase MET1 (Fragment).

 

445

 

383

 

1.00E-106

 

237

 

75

 

1153

 

emb|CAA05207.1| DNA (cytosine-5)-methyltransferase [Solanum lycopersicum]

 

1559

 

610

 

0

 

320

 

94

 

1153

 

SGN-U323958

 

5381

 

2252

 

0

 

1148

 

99

 

1153

 

P34881|DNMT1_ARATH DNA (cytosine-5)-methyltransferase AthI (EC 2.1.1.37) (DNA methyltransferase AthI) (DNA Metase AthI) (M.AthI) - Arabidopsis thaliana (Mouse-ear cress)

 

1534

 

429

 

1.00E-120

 

324

 

65

 

1153

 

AT5G49160.1 | Symbol: None | DNA (cytosine-5-)-methyltransferase (ATHIM), identical to SP:P34881 DNA (cytosine-5)-methyltransferase AthI (EC 2.1.1.37) {Arabidopsis thaliana} | chr5:19949456-19955595 FORWARD | Aliases: None

 

1534

 

429

 

1.00E-120

 

324

 

65

 

CTGCAGGGGTTGATGGCCTATGTAGTATGTCAATTACTAGAAATTGTTGGACCTAAGGGATCTAAACAAGCTAAAGTAGATTCTACAAATGTTAAAGTCAGAAGATTCTTCAGACCAGAGGATATATCTTCAGATAAGGCATACCTCTTCTGATATCCGGGAGATCTATTACAGTGAAGATATACATACCAGTTCCTGTGGAAATAATCAAAGGAAAATGTGAAGTGAGGAAGAAGTATGATATTTCCTCTGAAGATGTCCCTGCCATGTTCGACCATATTTTCTTTTGTGAATATTTGTATGATCCATTGAATGGATCCCTTAAGAAGTTACCAGCTCAGATAAACCTGAGATTGTCAAAAATTAAGCTAGATGACGCAACATCTAGGAAGAGGAAGGGGAAGGGAAAAGAAGGAGTGGATGAAGTTGGGGAACTAAATGAAACTTCTCCACAGAATCGTTTGTCCACATTAGATATCTTTGCTGGTTGTGGTGGCTTGTCTGAGGGGTTGCAGCATTCGGGTGTCACAGATACAAATTGGGCAATTGAATACGAAGCGCCTGCTGGAGATGCATTTAGACTTAATCATCCAAAGACAAAGGTGTTCATACATAATTGCAATGTGATTTTGAGGGCTGTCATGCAGAAGTGTGGAGATTCTGATGACTGTATCTCAACTCCAGAGGCTTCTGAATTAGCTGCAGCAATGGATGAGAGCGAACTGAATAGTTTGCCACTGCCTGGACAAGTTGATTTCATTAATGGAGGCCCTCCTTGTCAGGGGTTTTCTGGAATGAATAGATTTAATCAGAGCACCTGGAGTAAAGTACAGTGTGAGATGATTCTGGCATTTTTATCCTTTGCTGATTATTATCGGCCCAAGTTTTTTCTCTTGGAGAATGTTAGGAATTTTGTTTCGTTCAACCAAAAACAAACATTTCGCTTAACTGTTGCTTCCCTTCTTGAGATGGGTTATCAGGTTAGGTTTGGTATCCTTGAAGCCGGAGCGTATGGAGTTCCTCAGTCTAGGAAGAGAGCATTTATCTGGGCTGCCTCCCCAGAGGAGGTTCTTCCAGAGTGGCCAGAACCAATGCATGTTTTTGCTGTCCCACAATTAAAAATCGCATTATCTGAAACTTCATACTATGCAGC

 

1153

 

39112

 

Singlet13863

sgn|E371104

653

TC173291 UP|O49889_LYCES (O49889) DNA (Cytosine-5)-methyltransferase , complete

5379

Show
Singlet13863

Singlet13863

 

sgn|E371104

 

653

 

TC173291 UP|O49889_LYCES (O49889) DNA (Cytosine-5)-methyltransferase , complete

 

5379

 

1203

 

0

 

623

 

99

 

653

 

AK111461|Os07g0182900 Cytosine-5 DNA methyltransferase MET1 (Fragment).

 

445

 

286

 

6.00E-78

 

146

 

88

 

653

 

emb|CAA05207.1| DNA (cytosine-5)-methyltransferase [Solanum lycopersicum]

 

1559

 

316

 

1.00E-86

 

148

 

99

 

653

 

SGN-U323958

 

5381

 

1203

 

0

 

623

 

99

 

653

 

P34881|DNMT1_ARATH DNA (cytosine-5)-methyltransferase AthI (EC 2.1.1.37) (DNA methyltransferase AthI) (DNA Metase AthI) (M.AthI) - Arabidopsis thaliana (Mouse-ear cress)

 

1534

 

253

 

5.00E-67

 

144

 

79

 

653

 

AT5G49160.1 | Symbol: None | DNA (cytosine-5-)-methyltransferase (ATHIM), identical to SP:P34881 DNA (cytosine-5)-methyltransferase AthI (EC 2.1.1.37) {Arabidopsis thaliana} | chr5:19949456-19955595 FORWARD | Aliases: None

 

1534

 

253

 

9.00E-68

 

144

 

79

 

TTTTTTTTTGTTTTAATTTTTTTTGTTTGAACCCAACCTCTAAATAGAGGGTTATAGGTGAAACTGCAAATTTAATAAATGAGTAACTGATATAATTTGGCAATGTGAATGGTAATTGACATGCATGTAAAATTCACAGCTTAAAAAAGTTCTAAGTGAGCCTATTTTTGCTCTCAACAGCTTCTTTGAGTTTTCTTCCAAGCGCATATGCCAAAGGAGGTGGAACAGCATTTCCTATTTGCCTGTGCTTGTGCAAGATGTTACCAGCAAATTGGTAGCTGTCTGGGAAACCTTGAGAACGTGCACATTCACGAACTGTAACAATCCTGTCTTGATCTGGATGAAAGCACATCCCCACCTTGCCCATCGGCTGGGGATCAGTAATAGAAGTGGGGAAGTTCCCATCCCAATCCAACCTTCCAAAGAGCCCCTTCCACTGGTTGTGCCGCTTAGCAGTGTTAGGCAGGCACCATGGAATCAAATCAACTAGTTGACCATTAGATAGTTTAACCTTTTCATCTTCAAGGTCACGCCAATCAGCTCCTGGCCGCTTGGGGATTCTTTGGCACCTGATTAGGTTAAGCTCATTCATTCTCTTTTGAAATGTGATCAGATAATGTTATTGAGCTGGCCCCGGATTTTCTTTTTGAAAC

 

653

 

13863

 

Singlet10400

LEFL2022G05

696

TC173291 UP|O49889_LYCES (O49889) DNA (Cytosine-5)-methyltransferase , complete

5379

Show
Singlet10400

Singlet10400

 

LEFL2022G05

 

696

 

TC173291 UP|O49889_LYCES (O49889) DNA (Cytosine-5)-methyltransferase , complete

 

5379

 

1187

 

0

 

662

 

97

 

696

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

696

 

emb|CAA05207.1| DNA (cytosine-5)-methyltransferase [Solanum lycopersicum]

 

1559

 

104

 

3.00E-21

 

52

 

100

 

696

 

SGN-U323958

 

5381

 

1187

 

0

 

662

 

97

 

696

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

696

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GGAGAACTCAGCAACAGCACACCCCATCTCCCTCAACTTCTCCGCCGCACCAGCTTCTACTCTCCATTTCCGCCGAAAAATCACCTTTCACCGGCAAAGCCAGCAGCCTCTGGTCCCTCCTTTATCTTCTCCCTTCGCTGCTCTGGCCACCATCGCTGGTCGCTGGCGAGAACTACAACGAAAATCCCTTCGCCTCCGCTCTCCTCTCTCCCTCTTCCGCCGCCCTGCTCCTCACTTCTCACTTCTCCATTGAAGTCGACGGACGGGATAACGGCAGCGACGACTGCTCCGCCCAGCTACTGTGGCGAAGTAGCAGCAAGCTGTGACCAGCAAACTCCGGCAAAGCAGCGATAACAACTCAGGCCAGCAGTGGGGCAGCAACGACTGCTCTGCCCAGCAGCTTTGGCGAAGCAGCAAGCTGTGACCAGCAAACTCCGGCGAAGCAGCGATAACAACTCAGGCCAGCAGTGGGGCAGCAACTCCGGTTGGTGAGGATGGCGTCACCCCAACCTAATTCGGAGTCGGTATTAGAACTTCCGAACAACGACAAATCTGGACACAAAAAGAACAAACGCAAACAAGATTCTGTGTCAAAAAGGAAGGCATCTGCAACTGGTAAGAAGGAAAAGAAACAGGCTGTTTCTGAAACTAT

 

652

 

10400