KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Contig7309

LC03DC02/LC10DE08/LC10DC08/LC13DB05/LC20DH07/LC13BE02/sgn|E366984/sgn|E336950/sgn|E300903/LEFL2024A06/LEFL2010B01/LC22BG10/sgn|E287132/sgn|E332361/sgn|E263314/LC13DH10/sgn|E256440/LC10AD04/LC08AB12/LC08CE05/LC11DG11/LC18AB08/LC16DG08/LC15AB11/LC12BC02/LC21BC05/LC21AC06/sgn|E310409/LC02DD01/LC08BC05/LC10CC12/sgn|E366913/LC19CG12/sgn|E204002/sgn|E205003/sgn|E211468/sgn|E203664/sgn|E265430/sgn|E395173/sgn|E250867/sgn|E300430/sgn|E276778/LC03CA12/LC13AB03/LC10CD01/sgn|E374101/sgn|E330953/sgn|E236158/sgn|E275471/sgn|E347458/sgn|E273648/LB13CE01/sgn|E390864/LC01CF11/LC11CC03/LC11BG06/LC11AC03/sgn|E284585/sgn|E287714/sgn|E374100/sgn|E286961/sgn|E371842

3924

TC172149 similar to GB|AAP21170.1|30102504|BT006362 At3g19170/MVI11_8 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (87%)

3417

Show
Contig7309

Contig7309

 

LC03DC02/LC10DE08/LC10DC08/LC13DB05/LC20DH07/LC13BE02/sgn|E366984/sgn|E336950/sgn|E300903/LEFL2024A06/LEFL2010B01/LC22BG10/sgn|E287132/sgn|E332361/sgn|E263314/LC13DH10/sgn|E256440/LC10AD04/LC08AB12/LC08CE05/LC11DG11/LC18AB08/LC16DG08/LC15AB11/LC12BC02/LC21BC05/LC21AC06/sgn|E310409/LC02DD01/LC08BC05/LC10CC12/sgn|E366913/LC19CG12/sgn|E204002/sgn|E205003/sgn|E211468/sgn|E203664/sgn|E265430/sgn|E395173/sgn|E250867/sgn|E300430/sgn|E276778/LC03CA12/LC13AB03/LC10CD01/sgn|E374101/sgn|E330953/sgn|E236158/sgn|E275471/sgn|E347458/sgn|E273648/LB13CE01/sgn|E390864/LC01CF11/LC11CC03/LC11BG06/LC11AC03/sgn|E284585/sgn|E287714/sgn|E374100/sgn|E286961/sgn|E371842

 

3924

 

TC172149 similar to GB|AAP21170.1|30102504|BT006362 At3g19170/MVI11_8 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (87%)

 

3417

 

6704

 

0

 

3411

 

99

 

3924

 

AK060417|Os02g0761400 Hypothetical protein.

 

100

 

135

 

2.00E-31

 

100

 

69

 

3924

 

dbj|BAB02957.1| zinc metalloprotease (insulinase family) [Arabidopsis thaliana]

 

1052

 

1566

 

0

 

1007

 

75

 

3924

 

SGN-U313804

 

3914

 

7515

 

0

 

3909

 

99

 

3924

 

Q9LJL3|PREP1_ARATH Presequence protease 1, chloroplast/mitochondrial precursor (EC 3.4.24.-) (PreP 1) (AtPreP1) (Zinc metalloprotease 1) (AtZnMP1) - Arabidopsis thaliana (Mouse-ear cress)

 

1080

 

1566

 

0

 

1007

 

75

 

3924

 

AT3G19170.1 | Symbol: ATZNMP | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers | chr3:6625427-6631946 REVERSE | Aliases: MVI11.6, ATPREP1, ATZNMP

 

1080

 

1566

 

0

 

1007

 

75

 

GTTCTGACCATAAACCCCATCTTCTTCTTCACACACTTCCTTTCTTTTATCTTTCTCCGCAAGACATCAATGGAGAGAGCGGTGCTTCTTCGCTCTCTATCTTCTACTTCCACTCTCGCTTTCTCTAGAATCTTCTCACGCTCTTCACACAGATTCGCTTCTTACTCAGCTAGACGACACCGTTTACTCCAGAATCTTCAACGCCGGCGTTCACTTGTTCGGAGTAACGTTCGCGGAATATCATCTTCAATCAACTTGAAAAGACAGTTTTACCCTTTATCTGTTCGAGCTATCGCTACTTCTTCCCCTCAATCATCTCAAGAGTTTCTTGGTGCTGATGATGAAGTTGCGGAGAAATTCGGGTTCGAGAAAGTGTCTGAGCAGTTTATTGATGAGTGTAAATCTAAAGCTGTATTGTATAAACACAAGAAAACAGGCGCTGAAGTAATGTCGGTTTCCAATGACGATGAGAATAAAGTTTTCGGTGTTGTCTTCCGGACACCTCCGAAAGATTCTACTGGAATTCCTCACATATTAGAACATAGTGTACTGTGCGGTTCAAGAAAGTATCCCCTGAAAGAACCATTTGTTGAACTGTTGAAGGGAAGCTTGAACACTTTTCTGAATGCTTTCACATATCCAGATAGGACATGTTATCCTGTGGCGTCCACAAATACAAAGGATTTCTACAACCTGGTTGATGTGTACTTAGATGCTGTCTTTTTCCCTAAATGTGTGGAGGATTTCCAAACATTTCAACAAGAGGGTTGGCATTATGAACTGAATGACCCCTCAGATGAAATTACTTTTAAAGGGGTTGTGTTCAATGAGATGAAGGGAGTTTATTCTCAGCCTGATAATCTACTGGGACGAACTTCTCAGCAGGCGCTTTTTCCTGATAATACCTATGGTGTTGACAGTGGTGGTGACCCACGAGTGATTCCTAGCCTTTCTTTTGAGGATTTTAAGGAGTTCCACAGAAAATTTTACCATCCTAGCAATGCAAGAATATGGTTTTATGGAGACGATGACCCAAATGAACGTCTGCGGATCTTAAGTGAGTATTTGAACATGTTTGATGCTAGTTCAGCTCCACACGAATCAAGAGTTGAACCACAAAGACTATTCTCGGAGCCGGTCAGGATTGTAGAAAAATATCCCGTTGGGGAAGATGGGGACCTGAAAAAGAAGCACATGGTGTGCGTTAATTGGCTGCTATCTGACAAGCCACTGGATTTGGAAACTGAGCTTGCCCTAGGATTTCTGGATCATCTGCTTTTGGGAACTCCAGCTTCTCCCTTGAGGAAGATCTTGCTAGAAAGTGGTTTAGGAGATGCTATTGTTGGTGGAGGGATTGAGGATGAGCTCCTTCAGCCTCAGTTTAGCATTGGGTTGAAGGGTGTCTCAGAAGAGAACATTCAAAAGGTTGAAGAATTGATTATGAGCACCCTACAAGGCTTAGCTGAGAAAGGTTTTGATTCGGATGCCGTGGAGGCATCAATGAACACAATTGAATTTTCTCTTAGAGAAAATAACACTGGCTCATTCCCACGTGGTTTAGCATTGATGCTCCGCTCCATTGGGAAATGGGTTTATGACATGGATCCATTTGAACCACTGAAGTATCAGAAGCCTTTGGAGGCCCTGAAAGCCAGAATAGCTAAGGAAGGCTCCAAAGCTGTTTTTGCTCCTTTAATGGACCAATACATTTTGAGGAATCCACACCGTGTAACGGTTGAGATGCAGCCTGACCCAGAGAAGGCATCTCGTGAAGAACAAATAGAAAAGGAAACACTGGATAAAGTTAAAGCAAGCATGACCCAAGAGGATCTTGCTGAACTGGCTCGAGCAACACATGAGCTACGGTTAAAGCAAGAAACTCCTGACCCACCAGAAGCTCTAAAGAGTGTTCCCAGCCTCTCTCTACAAGATATTCCTCGAGAACCTGTCCTAGTTCCAACTGAGATTGGAGACATCAATGGGGTAAAAGTTTTGAAGCACGACCTCTTCACAAACGATGTTCTTTATGCTGAAGTTGTCTTCAACTTGAGCTCATTGAAGCAAGAGCTGCTACCATTAGTCCCACTTTTCTGTCAGTCTCTGCTGGAGATGGGCACAAAGGATTTAGACTTTGTGCAGTTGAACCAGTTAATTGGAAGGAAAACTGGAGGGCTATCAGTCTATCCTTTCACCTCATCCGTGCATGGCAAGGTGGAGCCATGTAGCAAGATAATAGTTCGAGGCAAAGCCATGTCACAACGTACAGAAGATTTATTTTACTTGATCAACCGCGTTCTTCAAGATGTCCAGCTTGATGACCAAAAGCGTTTCAAGCAGTTCGTTTCTCAAAGCAGATCGAGAATGGAGAATCGTCTAAGAGGCAGTGGTCATAGCGTTGCTGCTGCAAGGATGGGTGCTAAGCTTAACGTTGCAGGGTGGATATCTGAACAAATGGGTGGTGTTAGCTACTTGGAATTTCTGAAGGTTCTTGAAGACCAAGTTGAGAAGGATTGGTCCCAAATATCATCATCCCTTGAGGAGATCCGAAAATCTTTACTTTCCAAGAATGGGTGTCTGATAAATTTGACAGCTGATGGGAAGAATCTCAACAACGCGGAGAAACATATTAGCAAATTTCTTGATTTGCTTCCAAGCACATCTCTAGTGGAGCCAGCTGCTTGGAATGCACAGTTGTCTCGCTCAAATGAAGCTTTTGTTGTTCCTACTCAGGTGAATTATGTTGGAAAAGCAGCTAATCTGTATGAAGCTGGTTATGAGCTTAAAGGCAGTGCTTATGTTATTTCTAATTATACAAGTAATACATGGCTCTGGGATCGTGTACGTGTTAGTGGTGGAGCTTATGGAGGATTTTGTAGTTTTGACTCCCATTCAGGGGTATTCTCATTTTTATCCTACCGAGACCCAAATTTATTGAAGACACTTGATGTGTATGACGGAACCAGTAGTTTCCTTAAAGAACTTGAAATGGATAATGATGCACTCACAAAGGCAATTATTGGGACTATTGGAGATGTAGATTCTTACCAGTTGCCTGATGCCAAAGGGTACAGTAGTTTATTACGATATTTACTGGGAGTAACAGATGAAGAAAGACAAAGGAGACGTGAGGAGATATTATCAACAAGTCTGGAAGATTTCAGGAAATTTGGAGACGTCATGGAGGCAGTTAAAGATAAAGGGGTGGTTGTTGCTGTAGCATCACCAGATGATGTTGAGGCAGCCAACAAGGAGCGTTCTAACTTCTTGGAAGTCAAGAAAGCACTCTGATTCTGATCAAGTCTTTCTCGGAAAATGCTTGTATGCATTATTTGCTGTTAGAATCCTCAATCCCGTATTAAACAAAAGGAAGCCAAGAAGGGGAAAAAAAGACTAGAGAATCAGGAAGAATACCAATTCTTTTTTCTTGAGAACATAGTAGCTTTACAGAAGCTTTGTAAGGCAAAAAAATCAGTTTTTAAGTTTAAGAAAAAAGTCTCAAGATTACAGTTTTTTAACCGATCAATTTATCTGCTTTTAAGTTCAAGAAAAAAGTCTCAAGATACTTGTTGTTTTGCAATGGTATAATTAACCTTTATAAGTTAGAAAGAAACTATGTCAGTGAATTTGTTTTAAACTTGCACCTGCTTGCCCAAGGTTCACTGGCTGGCCACCTGCTAGAATGTGGTTGCCAACTTACTGGAGGATACTATATGCATCCAGGAGATAAATACCGTGATATATCTCTTCAAGATCTCCTAGATTTATCTCTTCCTTTTGCGGAAGTTAGCTTTGATGGGAAAGTATGTGTAGCAAAGGCGGAAAGCAGTGGTGGGGTTTTGAATCCCTGCACGTGTGCTGAGCAGCTTCTGTATGAAGTGGGGAATCCTAGTAGCTACATAACCCCAGACGTGGTTGTAGATTTTC

 

3924

 

29993

 

Contig8256

FA33DD10/LEFL2024O17/FC02AB05/LEFL2024E15/LEFL2021O22/LEFL2023K15/LEFL2019M21/LEFL2022L22/LEFL2046M24/LEFL2051B18/LEFL2001DF02/FC05AB09/LEFL2002CH04/LEFL2047D15/LEFL2017P15/LEFL2018K17/FA29DC04/LEFL2042F11/LEFL2020M24/LEFL2016C12/LEFL2012I22/LEFL2045E03/LEFL2017F12/LEFL2017E24/LEFL2004F20/FC20AG01/LEFL2020A16/FC16DA12/FA32BC06/FA10DF03/sgn|E256195/sgn|E259263/FA35AH05/FA16AB09/sgn|E253151/FA32CH03/sgn|E257669/sgn|E251380/FA42BG02/FA55BB01/FC08DC11/sgn|E274232/FA55CH01/sgn|E264541/sgn|E275444/FA09AA08/FA04BH07/sgn|E258906/FA10DG05/FA24AB10/FA26CH05/sgn|E396930/FA06BA04/sgn|E253017/sgn|E250284/sgn|E260059/sgn|E274175/sgn|E256492/FA30DE03/FA20CG05/sgn|E260777/sgn|E273830/sgn|E251317/sgn|E275409/sgn|E251046/sgn|E264126/FA27AF06/FA35AD05/sgn|E274209/sgn|E258145/sgn|E250372/sgn|E250705/FA56AE12/FA23DE06/FA23BH07/FA15DD11/FA09CD07/sgn|E275334/sgn|E254879/FA27BG10/FA26BH07/FA42CE12/sgn|E258952/sgn|E255355/sgn|E264031/sgn|E253747/sgn|E263401/sgn|E259751/FA29DF12/FA11BH06/FA14DE11/sgn|E259033/sgn|E254452/FC26BF07/FC26BE07/sgn|E262520/sgn|E370120/sgn|E368826/FA42BB05/FA36AH06/FA42AB06/FA25DF06/sgn|E255334/sgn|E250125/FA35DA11/FA17DA08/FA20BA05/FA28AE06/FA19BC06/FA07CB01/FA54CF10/FA36BF11/FA13CG08/FA35AH03/FA32CA04/sgn|E274852/sgn|E250900/sgn|E275714/sgn|E253929/sgn|E274347/FA57DH02/FA35AG01/sgn|E260823/sgn|E274164/sgn|E263787/sgn|E556786/FA33BD09/FA54DF01/sgn|E263804/FA51BB05/FB11AC12/FA33BE07/FA26BD01/sgn|E252128/FC15DH12/sgn|E261058/sgn|E260244/sgn|E261371/sgn|E276448/FA53AE06/sgn|E555857/FC19DA05/sgn|E274335/FB13DB09/FA34BF03/sgn|E254031/FB18BA07/sgn|E395091/sgn|E262315/sgn|E256553/sgn|E252524/FA55CA08/FA22BG03/FA28DC06/FA28DC08/FC19BC05/sgn|E254197/sgn|E254775/sgn|E263100/sgn|E275531/FB13CA03/FB18DC05/sgn|E256950/sgn|E275069/FB10CF05/sgn|E263391/sgn|E256508/FB12CD07/FB04BF07/sgn|E263557/sgn|E260934/sgn|E396929/sgn|E396401/sgn|E368825/sgn|E370119/FC03DD09/sgn|E257064/sgn|E203767/sgn|E338303/sgn|E291897/sgn|E296533/sgn|E301228/sgn|E337887/LEFL2006D07/sgn|E345675/sgn|E341982/LEFL2029P08/LEFL2019B04/sgn|E287599/sgn|E244865/

3809

TC179644 UP|Q42873_LYCES (Q42873) Lipoxygenase , complete

2859

Show
Contig8256

Contig8256

 

FA33DD10/LEFL2024O17/FC02AB05/LEFL2024E15/LEFL2021O22/LEFL2023K15/LEFL2019M21/LEFL2022L22/LEFL2046M24/LEFL2051B18/LEFL2001DF02/FC05AB09/LEFL2002CH04/LEFL2047D15/LEFL2017P15/LEFL2018K17/FA29DC04/LEFL2042F11/LEFL2020M24/LEFL2016C12/LEFL2012I22/LEFL2045E03/LEFL2017F12/LEFL2017E24/LEFL2004F20/FC20AG01/LEFL2020A16/FC16DA12/FA32BC06/FA10DF03/sgn|E256195/sgn|E259263/FA35AH05/FA16AB09/sgn|E253151/FA32CH03/sgn|E257669/sgn|E251380/FA42BG02/FA55BB01/FC08DC11/sgn|E274232/FA55CH01/sgn|E264541/sgn|E275444/FA09AA08/FA04BH07/sgn|E258906/FA10DG05/FA24AB10/FA26CH05/sgn|E396930/FA06BA04/sgn|E253017/sgn|E250284/sgn|E260059/sgn|E274175/sgn|E256492/FA30DE03/FA20CG05/sgn|E260777/sgn|E273830/sgn|E251317/sgn|E275409/sgn|E251046/sgn|E264126/FA27AF06/FA35AD05/sgn|E274209/sgn|E258145/sgn|E250372/sgn|E250705/FA56AE12/FA23DE06/FA23BH07/FA15DD11/FA09CD07/sgn|E275334/sgn|E254879/FA27BG10/FA26BH07/FA42CE12/sgn|E258952/sgn|E255355/sgn|E264031/sgn|E253747/sgn|E263401/sgn|E259751/FA29DF12/FA11BH06/FA14DE11/sgn|E259033/sgn|E254452/FC26BF07/FC26BE07/sgn|E262520/sgn|E370120/sgn|E368826/FA42BB05/FA36AH06/FA42AB06/FA25DF06/sgn|E255334/sgn|E250125/FA35DA11/FA17DA08/FA20BA05/FA28AE06/FA19BC06/FA07CB01/FA54CF10/FA36BF11/FA13CG08/FA35AH03/FA32CA04/sgn|E274852/sgn|E250900/sgn|E275714/sgn|E253929/sgn|E274347/FA57DH02/FA35AG01/sgn|E260823/sgn|E274164/sgn|E263787/sgn|E556786/FA33BD09/FA54DF01/sgn|E263804/FA51BB05/FB11AC12/FA33BE07/FA26BD01/sgn|E252128/FC15DH12/sgn|E261058/sgn|E260244/sgn|E261371/sgn|E276448/FA53AE06/sgn|E555857/FC19DA05/sgn|E274335/FB13DB09/FA34BF03/sgn|E254031/FB18BA07/sgn|E395091/sgn|E262315/sgn|E256553/sgn|E252524/FA55CA08/FA22BG03/FA28DC06/FA28DC08/FC19BC05/sgn|E254197/sgn|E254775/sgn|E263100/sgn|E275531/FB13CA03/FB18DC05/sgn|E256950/sgn|E275069/FB10CF05/sgn|E263391/sgn|E256508/FB12CD07/FB04BF07/sgn|E263557/sgn|E260934/sgn|E396929/sgn|E396401/sgn|E368825/sgn|E370119/FC03DD09/sgn|E257064/sgn|E203767/sgn|E338303/sgn|E291897/sgn|E296533/sgn|E301228/sgn|E337887/LEFL2006D07/sgn|E345675/sgn|E341982/LEFL2029P08/LEFL2019B04/sgn|E287599/sgn|E244865/

 

3809

 

TC179644 UP|Q42873_LYCES (Q42873) Lipoxygenase , complete

 

2859

 

5247

 

0

 

2685

 

99

 

3809

 

AK072689|Os03g0700700 Lipoxygenase (EC 1.13.11.12).

 

877

 

986

 

0

 

879

 

56

 

3809

 

gb|AAA74393.1| lipoxygenase

 

859

 

1731

 

0

 

859

 

98

 

3809

 

SGN-U314558

 

2995

 

5271

 

0

 

2727

 

99

 

3809

 

P38416|LOXB_SOLLC Lipoxygenase B (EC 1.13.11.12) - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

859

 

1731

 

0

 

859

 

98

 

3809

 

AT1G55020.1 | Symbol: None | lipoxygenase (LOX1), identical to SP:Q06327 | chr1:20529375-20533940 FORWARD | Aliases: None

 

859

 

1098

 

0

 

846

 

63

 

AACGACTAAAATCTATCTTTTCTTTTCTTAATTAAAAAAAAAATATTTCTGTTTAAATAGTTAATCATGTCTTTGGGTGGAATTGTGGATGCCATCCTTGGAAAAGATGATAGGCCAAAAGTGAAAGGAAGAGTGATTTTGATGAAAAAAAATGTTCTAGACTTCATTAATATAGGTGCTTCAGTTGTTGATGGCATTTCTGATTTACTTGGCCAAAAAGTCTCTATCCAATTGATAAGTGGTTCTGTTAATTATGATGGTTTGGAAGGGAAACTGAGCAATCCAGCATACTTAGAGAGTTGGCTTACAGACATCACCCCAATAACAGCAGGGGAATCAACTTTTAGTGTTACATTTGACTGGGATCGTGACGAGTTTGGAGTTCCAGGAGCATTCATCATCAAGAATCTTCATCTTAATGAGTTCTTTCTCAAGTCACTCACACTCGAAGATGTTCCTAATTATGGAAAAATCCATTTTGTATGCAATTCTTGGGTTTATCCTGCTTTTAGATACAAGTCTGACCGCATTTTCTTTGCCAATCAGGCTTATCTCCCAAGTGAAACACCACAACCATTGCGAAAATACAGAGAAAATGAACTGGTAGCTTTGCGAGGAGATGGAACTGGAAAGCTTGAAGAATGGGACAGGGTTTATGATTATGCTTGCTACAATGACTTGGGTGAACCAGATAAGGGGGAAGAGTATGCTAGGCCTATCCTTGGAGGGTCCTCTGAGTACCCGTATCCTCGTAGAGGCAGGACAGGCCGCGAACCAACCAAAGCAGATCCTAATTGCGAGAGCAGGAACCCATTGCCTATGAGCTTAGACATATATGTCCCAAGGGACGAGCGATTTGGTCATGTGAAGAAGTCAGACTTTTTGACGTCGTCCTTAAAATCCTCTTTGCAAACGCTTCTCCCTGCGTTTAAGGCTTTGTGCGATAACACGCCTAATGAGTTCAATAGCTTTGCGGATGTACTTAATCTCTATGAAGGAGGAATCAAGTTGCCTGAAGGCCCTTGGTTGAAAGCCATTACTGATAACATTTCCTCAGAGATACTAAAAGACATCCTTCAAACGGATGGTCAAGGCCTACTTAAGTACCCAACTCCTCAGGTTATTCAAGGCGATAAAACTGCATGGAGGACGGATGAAGAATTTGGGAGAGAAATGTTGGCAGGATCCAATCCTGTCTTAATCAGTAGACTCCAAGAATTTCCTCCGAAGAGCAAGTTGGATCCAACCATATATGGAAACCAAAACAGTACAATTACCACAGAACATGTACAGGATAAGTTGAATGGATTAACAGTGAATGAGGCAATCAAGAGTAACAGGTTATTCATATTGAACCACCATGACATCGTGATGCCACTATTGAGGAAAATTAACATGTCAGCAAACACAAAAGCCTATGCCTCAAGAACTCTGCTCTTCCTACAAGATGATAGAACTTTGAAGCCACTAGCAATTGAACTAAGCTTGCCACATCCAGACGGAGATCAATTTGGTACTGTTAGTAAAGTATATACACCAGCTGACCAAGGTGTTGAAGGTTCTATCTGGCAGTTTGCCAAAGCCTATGTAGCAGTGAATGACATGGGCATTCATCAGCTCATTAGCCACTGGTTGAATACACACGCGGTGATCGAACCATTTGTGATTGCAACAAATAGGCATCTAAGTGTGCTTCATCCCATTCATAAACTTCTTCATCCTCATTTCCGTAACACGATGAACATAAATGCTTTAGCAAGAGAGACCTTGACCTATGATGGTGGTTTTGAGACGTCTCTTTTTCCTGCCAAATATTCCATGGAAATGTCAGCAGCAGCTTACAAAGATTGGGTTTTCCCTGAACAAGCACTTCCTGCTGATCTCCTCAAAAGAGGAGTGGCTGTTGAGGACTTGAGCTCCCCACATGGCATTCGTTTACTGATTCTGGACTATCCATATGCTGTTGATGGCTTGGAAATTTGGGCAGCAATCAAAAGTTGGGTAACAGAATATTGCAAGTTCTATTACAAATCTGACGAGACAGTAGAGAAAGACACTGAACTCCAAGCTTGGTGGAAGGAGCTCCGCGAAGAAGGACATGGCGACAAGAAAGATGAGGCTTGGTGGCCTAAACTGCAAACTCGACAAGAGCTCAGAGATTGTTGCACCATCATTATATGGATAGCTTCAGCACTTCATGCAGCACTCCATTTTGGCTTATACTCTTACGCTGGTTATCTCCCTAATCGCCCTACTTTAAGCTGTAATTTGATGCCAGAGCCAGGAAGTGTTGAGTATGAAGAGCTCAAGACAAATCCAGACAAGGTATTCCTAAAAACATTTGTTCCTCAGTTGCAATCACTGCTTGAAATTTCCATCTTTGAGGTCTCGTCAAGGCATGCTTCAGATGAGGTTTACTTGGGACAAAGGGACTCAATTGAATGGACAAAGGATAAAGAACCACTTGTAGCTTTTGAGAGGTTTGGAAAGATGCTAAGTGATATCGAGAATCGAATTATGATAATGAATAGTCATAAGAGTTGGAAGAACAGGTCAGGGCCTGTTAACGTTCCATATACGTTGCTCTTTCCCACAAGTGAAGAGGGACTCACAGGCAAAGGAATTCCCAACAGTGTGTCTATATAGAACTTATTATTCAATCAGTTTGTTGTGCTTGTGTTACTTGTTATTCCCAACCAAATAAACTCTTTGTTCCAAATAAAGAGTATTGTATTGTATTGTCTTGTGTGTTGTGTTGTATTGTATTATATTGTATAGTATTATTGATTTAAATACAATGTTTGTTGCACTTGTTTCTTGTTATTCCCAACCAAATAAACGCTCCTCATTTCGTTTCTCTTTCTCTCTCCTTAAACCCTGAAACTTCCTCTCTCGCTCAGATTTGTGACCGCTTTTATAAACTCCCTTCTCCATATCAGAGAAGTGGCTTAAACCCTAGCCGCTCCTCATTTCGTTTCTCTTTCTCTCTCCTTAAACCCTGAAACTTCCTCTCTCGCTCAGATTTGTGAATTTGTCTGCACAAATGGCTTTCTGCAACAAACTCGGTGGTCTGTTGAGGCAGAGCATTTCCACGGGAAATGCAGTAAGTGCAAATTCACCAACTCCAGCGATGCTTAATGCCATCCGGTGCATGTCATCAAAACTTTTTGTTGGTGGTCTTTCATGGGGAACAGATGATCAGTCACTGAAAGAGGCCTTTACTAGCTTTGGTGATGTTGTTGATGCAAAGGTAATCATTGACAGAGATTCTGGCAGATCAAGGGGATTCGGATTTGTGAACTTCTCAGATGAAGATTGTGCAAAAGAAGCTATGAACGCAATGGACGGTCAGCAACTGCATGGAAGGAATATCCGTGTTAATTTAGCCCAAGAGCGTGCCCCTAGAAGTGGTGGATATGGGGGTGGATATGGTGGTGGTGGTGGCGGCGGTGGATATGGTGGTGGTGGTGGCGGCGGTGGATATGGTGGGGGCTATGGTGGTCAAGCTAGAGATAACGATGCCTTCTAAGTCAGTTTTATCTTTGCTATTAGCTGTCATGTGTGCATGACAATATTTATCTTAATAGAGAGGACTCAGTGTGATAGCTTTTGTTGAATTTATCTTTTAAAACTTCTTTTCTGCAAGGTTTTTTTAGTATCAATAATTTTTCCAGATTTTATCACAAAGGTCATTTGTGCCCTAGATGCTGTTTATTGTAATCAATATTCAACTATGCGGCACTTTGCAATATTGTTCTTTTATTTATAGTGAAGACGATTAATATGAAAATGATTTAAAATGGAAAAAA

 

3809

 

30940

 

Contig22414

sgn|E555347/sgn|E336502/LEFL2053M14/sgn|E290737/FB08AD11/FB16CC03/FC14BD09/sgn|E369107/LEFL2008H22/LEFL1037CB06/LC18AB01/sgn|E342545/FC17BC09/FA14CD01/FC21AD12/LEFL2050N07/LEFL1089BH07/LEFL2024I22/LEFL2032B01/LEFL2028A22/LEFL1039BA11/LEFL1062AG08/FC17CB12/LEFL1086BF05/sgn|E346771/sgn|E275623/sgn|E212390/sgn|E367289/sgn|E246746/sgn|E307984/sgn|E269300/sgn|E555290/sgn|E212143/LC13BE01/FA18DE11/sgn|E299157/LA23BA01/FA26DB10/FA26DE11/sgn|E260210/sgn|E314084/FB04AE04/LEFL1059AE12/sgn|E268020/sgn|E210820/sgn|E344243/sgn|E209196/sgn|E240774/sgn|E234025/sgn|E367863/sgn|E233713/sgn|E353793/sgn|E351645/sgn|E354860/sgn|E356818/sgn|E340019/sgn|E353073

3747

TC176641 similar to UP|Q9ZVU7_ARATH (Q9ZVU7) T5A14.10 protein, partial (41%)

1863

Show
Contig22414

Contig22414

 

sgn|E555347/sgn|E336502/LEFL2053M14/sgn|E290737/FB08AD11/FB16CC03/FC14BD09/sgn|E369107/LEFL2008H22/LEFL1037CB06/LC18AB01/sgn|E342545/FC17BC09/FA14CD01/FC21AD12/LEFL2050N07/LEFL1089BH07/LEFL2024I22/LEFL2032B01/LEFL2028A22/LEFL1039BA11/LEFL1062AG08/FC17CB12/LEFL1086BF05/sgn|E346771/sgn|E275623/sgn|E212390/sgn|E367289/sgn|E246746/sgn|E307984/sgn|E269300/sgn|E555290/sgn|E212143/LC13BE01/FA18DE11/sgn|E299157/LA23BA01/FA26DB10/FA26DE11/sgn|E260210/sgn|E314084/FB04AE04/LEFL1059AE12/sgn|E268020/sgn|E210820/sgn|E344243/sgn|E209196/sgn|E240774/sgn|E234025/sgn|E367863/sgn|E233713/sgn|E353793/sgn|E351645/sgn|E354860/sgn|E356818/sgn|E340019/sgn|E353073

 

3747

 

TC176641 similar to UP|Q9ZVU7_ARATH (Q9ZVU7) T5A14.10 protein, partial (41%)

 

1863

 

3679

 

0

 

1856

 

100

 

3747

 

AK101299|Os03g0748000 YT521-B-like protein family protein.

 

661

 

548

 

1.00E-155

 

678

 

47

 

3747

 

gb|ABE87461.1| YT521-B-like protein [Medicago truncatula]

 

677

 

655

 

0

 

704

 

51

 

3747

 

SGN-U312943

 

3006

 

5112

 

0

 

2600

 

99

 

3747

 

Q4R5D9|YTHD2_MACFA YTH domain family protein 2 - Macaca fascicularis (Crab eating macaque) (Cynomolgus monkey)

 

579

 

208

 

1.00E-52

 

251

 

47

 

3747

 

AT3G13460.4 | Symbol: None | similar to expressed protein [Arabidopsis thaliana] (TAIR:At1g55500.1): similar to putative RNA-binding protein [Oryza sativa] (GB:XP_469739.1): contains InterPro domain YT521-B-like protein (InterPro:IPR007275) | chr3:4384721-4388484 REVERSE | Aliases: None

 

666

 

611

 

1.00E-175

 

684

 

51

 

AAAACAGCTTGTGCTCTTAGGCACAGAAACATGCCTGCAGTTTTAATATGATAGTTATACAAAGTTCAAAATCTTTCGCAAGCCAATATCAGAAAGGGAAACTTATAAGACATATAACGACGACTAACGAACTATAACAGTTTGTGTTCCTAGCTACATAACATGTCTGAAGTTTTCATTTGATAGTTGTACCAAAGTCTATCAACTAAACTGATGTTTGATCCATCCATCATCCGTTCACAGGATTACAAGGCTCACACCAAGTTGCAGGTCAGTGAACGACTGGCTTTAGAGGATGTGCTCTCAGTTTTGACATATCCAAGTTACTATCAAGATCTTCATCTAATTCCCCAACGACGCTTATGTTGTCTCCCCTTATGATATAAAGACCTAACACAAGTTGCTGTACACCTTCCTTTGTTGAATATACTCTCTCATGAGATTCATCAAGAATCAAGTTTGTAGCCTGGTCGAATCCTCTCAGAACTCCCACAATATTCCGTCCATCATTTGTAATAACTGAGATAGTTTGATCAACAAGAGACTCAAGCCCAAGTCCAGATGCCATGTTGCAGAGTGAGCTGAAACTTAGTTGTCAGCTTCTTGGTAAACTGATGCTAAAACCTGCGAAAAAAAATCGTCGAGGAGTTCTCGAAACTCGAACCNNNNNNNNNNNNNNNNNNNNNNNNGCTCTCTCTGACAATCCTTTTTCAGAACAAAATCTTCTCTCTCTCAATCTCAAAACCCAGACCTAAACCCTTTTTTTACTTTTTCTTTCTCTCTCTCTATAGTTGTGTGGCGGCTGCAACTCTCTCGAACCCATCTCTTCTCTTCTAGGGTTTCTATCTCCTTCCTTAAACCCTCTTTATCTTCAGGGTTTTACAGCTTCTCCTGTTGAAGATCTAGCTCGGAATGGCTGCTGGTGCTCCTCCTGCTGATCAAGCTGCAGATTTGCTGCAGAATTTGTCACTGGATTCTCGGAATAAGACTCTTGAAATTGCAGATACAAAAAAGAAGCCTTCTGGGAACCCTACAGATGGGGCAAACGGTCAGCTTCAGTCGGCTGATCGGTCTGTGACACCTGTGTTGCCAGAATTCATGGATCCAAATTTGTGCTATGTTCCTAACAGTTATGCCTCAACAGCATACTATTATGGATATGATGCTTCTGCTAACGAGTGGGAGGACTATGCACGATATACGAATCCGGATGGAGTTGAGATGCCTGGAGTTTATGGAGACAACAGTTCACTTATCTATCATCATGCCTATGGTTATGCACCCTATAGTCCATATTCACCTGCTACTTCGCCTGTCCCTACTGTGGGGCATGATGGCCAACTTTATGGATCGCAACAATATCACTATCCGTATTTCCAGCCTCTCCCCCTGACCAGTACTTCAAACACTAGTTCAGCTGCCCTGCCAAAAGGTGAGATTGCCACTTCTGCAGCAGCTGCTGACCAAACATCATTATCTGTGGATTCTGCTAAAGGGAACTCAAATGTCATTGTGAATGGTGGTGTAAAGGGAAATACTGGGCATATGCCTGTGAGGCCTGCATTCCAGAATTCATCCTTAAATGCTAATGGCTCTTATGGACCTGGCACATTGCCAGGAGGAGCTGCTTCAGGTTATCAGGACCCTAGACTGGGTTTTGATGGTGTTCGTTCTCCTATTCCATGGATTGATGGGTCAATGTTCACTGATGGGCAAGCTAGGCCAGTGGTGAACAATTCTTTTACGCCATCATTTTCAAATGGCTATGCTGCTCCATCAACAAAGAATCAGAATGTTCATCCACATGTAATGGGCATGCACCACCCAAGGTCTTCATCTAGTGTGAACACAACTAATGGGTATATGAATAGGATGTATCCCAACAAATATTATGGGCAGTTTGGGAACTCATTCAATTCTGGCATGGGGTTTGGGCCTAACCGGTATGATACTCGCGCTACAGGTCGTGGTGGGTGGATGACAGTTGATAACAGGTCTAAACCCAGGGGTAGAGGAAATAGTTTCTATGGCTATGGCAATGAAAACATGGATGGTTTAAATGAGCTCAACAGGGGACCGAGAGGTAAAGGATCCAAGAATCAGAAGAGTTCTACACCAGTTGCTCTGGCAGTCAAGGGGCAGAACATCCCTCTTGCTGTAACCAAAGATGCCGAGGAAGATAAACCAAGCCTGATGCCTGACAGAGAACAATACAACCATCCAGATTTTCCAGTGACATATGCTGATGCCAAGTTCTTTATCATCAAGTCTTACAGTGAAGACGATGTGCACAAAAGCATCAAATATAATGTGTGGGCTAGCACACCAAATGGCAACAAGAAGCTTGATGCTGCTTACCAAGAGGCTCAACAAAATTCTGGAGGCTGCCCAGTTTTTCTTTTCTTCTCGGTAAATACAAGTGGGCAGTTTGTTGGTGTTGCAGAGATGGTAGGGCCAGTTGATTTCAACAAGAATGTGGAGTATTGGCAGCAAGACAAGTGGGTCGGCTGTTTTCCTGTCAAGTGGCACATTGTGAAGGATGTACCCAATAGCTTGTTGAAACACATTACACTGGAAAACAACGAGAACAAGCCTGTTACGAACAGCAGAGATACTCAGGAGGTTAAAGTGGAGCAGGGTCTGCAAGTGCTCAAGATATTTAAGGATCATATTAGCAAACAGTGTATCCTTGATGATTTTGAGTTCTATGAGGATCGTCAGAAGAGAATTCAGGATAAGAAGGCCAAGCAACAGCTATTCCAGAAACAGTCTCAGGTATGGGAAGGTAAAGCTACTACTGAAGAGAAGAACAGAGATCATTCAAAGGTTGATCTCAAGCCACAAAAACCTACAGAAGTTTCAGCTTGTTTGAACAAAGAAAATTTACCGGCTGCTGCCCAGACTAGCACTGTGGAAGTCAAGCTTACCGAAATTGTACCAGTTACAAAAACTGGAGATGATGTGAAGGATGTTAAACCGGTCACTGTATCAGAAAAGAAACCTGTAGCAAATGGGGCTTCTAATGGATGCTAACTTCAGCTAATGAAGGGTGGTCTGTGGTTAAGAGGTCCTAGATTGGAGCTTTATGACAAGATGATATGCACATGAGTGGTGCTTGGTTAGATCTCATAACCATTGCTGCCCTTATTATCCGAGCAGCATTTGGAGTTGGTTGTTGCTGGAAATAAGTTCTAAGAGAAAATTCAATAGTTGGCAGGAAGTCTAGAGGCATCTGTTTCTAGAAGAGTTGAGAAAGTATGGAAGCCCCATTTCCCCTCATGGGACAGTTTCTTGGTATTTTTAGCTTTGATTAGTTTCAGACCTTGGTTTGGGTTTATGAATTTTTTTTGTTTCTTTTGTTTTTGTGGCTTATTTTAGGCAATTGCCTTTTTCCTTGTCGAGTTACATGGGTTTTAGATGAGGGTTTTTGTTATATTAGTCTATCTTATCAATCTGTTGTGTCAGTTCAGCATTGCTTTCCCCCCTTTAAACTACTGGTTAGAGCTAGAAACTAGGTCGGAGTGCATTGCGATATAGTTGAACTTTGAAGTTGTTAACGCTCGTTGGTTCTTTTTCTCTAAATTCATTTTTACTGAACAACTTCAGTCGCTTGTTAATTGTGTTTCGTGATTGTCCTGTTAGTAACTAGGATGTATGTATGTGTAAAGTTGTCATCCTAGAAGAAATAAGCTTCTGTGGCAAGTTCTAAAAATTTACTTGTTTTCTCAAAAAAAAAAAAAAAAAAAA

 

3747

 

45098

 

Contig9015

LEFL2037E15/LEFL2040A08/LEFL1070BC10/sgn|E365813/sgn|E373021/sgn|E294018/sgn|E260750/sgn|E242985/sgn|E240332/sgn|E259789/sgn|E259746/sgn|E256242/sgn|E238451/sgn|E236518/sgn|E228265/sgn|E284416/sgn|E246116/sgn|E257576/sgn|E257578/sgn|E242598/sgn|E260691/sgn|E208653/sgn|E311954/sgn|E257579/sgn|E282037/sgn|E257577/sgn|E208046/sgn|E227156/sgn|E227664/sgn|E223903/sgn|E311502/sgn|E224297/sgn|E234364/sgn|E302714/sgn|E352867/sgn|E349893/sgn|E537468/FB01DF06/sgn|E242863/FA18AG05/sgn|E272958/sgn|E201738/sgn|E537470/sgn|E266384/sgn|E311215/sgn|E299850/FA29DE11/sgn|E302713/sgn|E299728/LEFL1092CF02

3717

TC173772 similar to UP|Q84LI7_FRAAN (Q84LI7) Polygalacturonase-like protein, partial (88%)

3347

Show
Contig9015

Contig9015

 

LEFL2037E15/LEFL2040A08/LEFL1070BC10/sgn|E365813/sgn|E373021/sgn|E294018/sgn|E260750/sgn|E242985/sgn|E240332/sgn|E259789/sgn|E259746/sgn|E256242/sgn|E238451/sgn|E236518/sgn|E228265/sgn|E284416/sgn|E246116/sgn|E257576/sgn|E257578/sgn|E242598/sgn|E260691/sgn|E208653/sgn|E311954/sgn|E257579/sgn|E282037/sgn|E257577/sgn|E208046/sgn|E227156/sgn|E227664/sgn|E223903/sgn|E311502/sgn|E224297/sgn|E234364/sgn|E302714/sgn|E352867/sgn|E349893/sgn|E537468/FB01DF06/sgn|E242863/FA18AG05/sgn|E272958/sgn|E201738/sgn|E537470/sgn|E266384/sgn|E311215/sgn|E299850/FA29DE11/sgn|E302713/sgn|E299728/LEFL1092CF02

 

3717

 

TC173772 similar to UP|Q84LI7_FRAAN (Q84LI7) Polygalacturonase-like protein, partial (88%)

 

3347

 

3562

 

0

 

1842

 

99

 

3717

 

Os08g0157000|Os08g0157000 Mitogen-activated protein kinase 4.

 

392

 

640

 

0

 

366

 

80

 

3717

 

gb|AAP33475.1| polygalacturonase-like protein [Fragaria x ananassa]

 

474

 

739

 

0

 

470

 

74

 

3717

 

SGN-U313995

 

3620

 

3729

 

0

 

1938

 

99

 

3717

 

Q39024|MPK4_ARATH Mitogen-activated protein kinase 4 (EC 2.7.11.24) (MAP kinase 4) (AtMPK4) - Arabidopsis thaliana (Mouse-ear cress)

 

376

 

648

 

0

 

372

 

82

 

3717

 

AT3G61490.2 | Symbol: None | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein, weak similarity to SP:P27644 Polygalacturonase (EC 3.2.1.15) (Pectinase) {Agrobacterium tumefaciens}: contains PF00295: Glycosyl hydrolases family 28 | chr3:22769363-22771167 FORWARD | Aliases: None

 

476

 

718

 

0

 

476

 

71

 

GACGAGGACTCATCCAGTACAACAATAAAGAGAAGGAGAAAAAGATATGCAAAGTCAATTTACTTCACGGGCAACAACAATGGCAGCGTTCCAGTTCAAAAGTTCCCACATGATCACGCAGGGACTCTCTAGAAAATTGAAAAGGGAATCACAATTTAGCCACCCAAAAAGGAAAAGACACCAAATTTCCATTTACTCTTCTCTTCTTCTTCTCTTCTTGTTGTTGGGGAAAAAAAGGAGCTTTTTTTTTTTTTAATTTAGAGTGGTTATAGTTCAAGATTCTTCAACCCCTTTTCTTGTTTTGAGTTTTTCAGATCCCTTTTGGGGTTAATTTCATTTGAGATGTCTCTTGATTCAAGTTCAGCTGATCATGGTGGGCACAGTAACATAAGAGGGGTTCCAACTCATGGGGGTCGTTATGTTCAGTATAATGTGCACGGCTCTCTGTTTGAAGTTTCAAGAAAATATGTTCCTCCTATCAGACCTATTGGTCGTGGAGCTAATGGAATGGTTTGTGCTGCTGTGAACTCGGAGACACGTGAGGAAGTAGCTATTAAGAAGATTGGGAATGCATTTGATAATGTAATAGATGCCAAGAGGACATTAAGAGAGATAAAGCTTCTCAGTCACATGGATCATGAGAATGTGATTGCAATTAAAGATGTTATACGGCCTCCTCAAAAGAAAAATTTTAATGATGTGTACATTGTTTATGAACTGATGGACACTGATCTTCATCAGATTATTCATTCCAACCAACAGCTGACTGATGAACACTGTCGACATTTTCTGTACCAAATACTGCGAGGACTTAAGTACATTCACTCTGCCAATATCTTGCATCGTGATTTAAAACCCAGCAATTTGCTTGTCAATGCAAAATGTGACCTAAAGATTGGAGATTTTGGGCTAGCAAGGACGACAACTGAGACAGATTTCATGATGGAATATTGTGTGACACGCTGGTACCGTGCACCAGAGTTGCTACTAAATTGTTCAGAATATACATCGGCAATTGATATTTGGTCAGTGGGTTGCATACTCGGTGAAATATTGACAAGACAACCCCTTTTTCCTGGAAGAGATTACGTACACCAGTTGAGACTTATCACTGAGCTAATAGGCTCACCAGATGATGCCAGCCTTGGGTTTCTCCGGAGTAATAATGCCCGGAGATACGTTAGACAACTTCCAAGGTACCCAAGGCAACAATTTGCTGCCAGATTCCCAAATTCATCTCCCCGAGCTGTAGATTTGCTTGAAAAGATGCTCATCTTTGATCCAAGCAGGCGTATTACAGCTGATGAAGCTCTCTGTCACCCATACTTAGCACCTCTTCATGAAATCAACGAAGAACCTGTTTGTCCGAGGCCTTTCAGTTTGGATTTTGAGCAGCCATCTCTCACTGAAGATAATATCAAGGAGCTCATCTGGAGGGAAGCTGCAAAATTTAATCCTGATCCAACTCATTGAAAGAGACGTGGTTATATGATGTATACAATAAGCGTTTGGTGACATAACTTCTCTAAAATAGTGTATTAGATTTGTAATGTTCCCCAGTGAAGATGACTGAATAAATATGGTGGAGCTATTTGGTTCAAGAAATTGTTAGTGGCTTAAGTCAGATACTTATTCTCTTGTTGTGTTTGGTTTATTGGTGTTGTATAAAGAACCTAAAGAGTAGTCTACAATCAATTGGTTCTAAATACTGAAAAAACCTTGATGCCAGATCTCTCTGGCTTATAGAACTGAACATTATACCTGTTCAAGTTGTTTGACATAACATGGAAAATTGTTCATGTGAGAATGGACAGTTAACGAATGAGTTTTGAAGTTGTATGTCTATTGCAGTGTTTTACATGTTGATATGTATCTCTGCTTGGTCTATGTCCATAATTTGCCTTCTTATTCATGTAGTTGCTGTAGCACTATACACTTTTTTTCGGGATAGAAGTCTTCTAGTCGTGTTAGAGATTCATGTGCTAGTAGAGAATATATCATGTGATGAGTTTAAATAGAGTGACACTGTCATTTCCTTATTACCACTCGTCCTGTTGTTCCGTGACACCACTAACAGAGTTTGATTCGTATAACCGGCCCCAACTTGTTTGAAGTTGAGGTGTAGCAGTAGCTGCTGTTGTATGCACATGTTGTTGGATGTTACAGGGTTTACAGTGAAGATGAAAGCACTAAAATTTTTTTTTTTTCATTTTTCTTATATTGCTGATACATTTTGGATAGCTTATTATCAGTAATTCAATCTATAGGAACATCTTTGCATCTCTATGTTATCAATGGCCAAATTCTCTGTTGGAAAACTACACATTTCAGTCTTTTCTGGACCTTGATCAGGCAACAACTGACAAGGTGGAGGCTGCACACCACTAGTAATTCCTTCAATATCAGTACAAGTCCATGGATACTTCTTAGCCTTCTTTGCCATACTTATAGTCACATTTGAAATGCAGATACCGGTGAATGGATCCCCAGAAATCCCCTCAAGACGAGCAGCCATTGACACGTTCTCAGCCACTACATCCCGGTAATTGATCCCTTTTATCTCTGGTAATGCATTAGGATCCCAGTGAGTGTCTGCATGTTGTCCATAGTTGCCTGTCATCCAAAATACCCATTTCATGGTGTGCAATGTCATCCCTTTGACATATACATCTCTAACAAAACCGCCTCGGCCAACACCAGTCTTGATCCTCACCCCTGATTCAGTGTTGATAGCCGTGATGTCCTCTGCTCTAACGTCTTGAATCCCACCTGACATTTCACTTCCTAATGCTATTGCAGCACTATAAGGAGAAATGCAGGTGAGGCGCCTGATGATCAGTTGACTTGTTGGCATCCCATAATTTATACCATATTCATCCCAACCACTTTTAACTGCAACACAATCATCTCCAGATACAATGTAGTTGTCTTCAATTTTCATGTTTGTGCAAGAATCTGGATTGATCCCATCAGTGTTTGGAGATTTTACTGGAGCTAAAATAGTGATGCCTTGGACAATGATATTGCTGCTATAAACAGGATGGATATTCCAAGATGGAGAGTTGACAAGGGTTATATGTGATATCTGAATGTTATCAGAATGCATAATTTCAATCAAGTAAGGCCTTGTGTATTGTAGCTTTTTGCTGTGAAATTTCTGCCACCAAATCTCACCCTGTCCATCAATGGTCCCATTCTCACCTGTGATGATAACATCAGTGAGGTTAGTTCCAAATAAAAGACTTATGTACCTTCCACCTGATGTATCCCTTCCATGACCATATGATGGTAATGGGTCTATAACAGCCCACTCATTTATATCCTGAGAAGCAAGAAGAATAGCATCCTTATGAAGGAAAAGAGTGAAATGACTAGTAAGATTGAAGCTACCAGTGAGCCATTGACCAGCAGGGACAATAAGCTGAGCTCCACCATCTGATGCATACTGGCTCAACCGATTCACTGCTTCTTGAAATGCTTTTGTGTTGAGTGTTTTCCCATCACCAACTCCACCAAAATCTGTTATAGATGCACTGTGTGCTCTACAACTTATTGCTGAGTACTCTAAATCATAGTAAGAAGACTCATCAAGAATTCTTGATTTTCTTCCCTCAGCTCCACCTAGTAAACTTATAACCACCATCCCTAATACCACTACCAGCAACCAACTTGTCTTTTCCATTTGAGATGAGAGTGGAATTTTGTGCATTGCTTGGC

 

3717

 

31699

 

Contig14448

sgn|E546428/sgn|E272160/sgn|E256069/sgn|E258980/sgn|E368862/sgn|E258977/sgn|E256171/sgn|E257943/sgn|E252111/sgn|E256151/sgn|E262955/sgn|E263638/sgn|E368861/sgn|E578165/sgn|E541397/sgn|E296040/sgn|E314649/sgn|E259055/sgn|E369858/sgn|E366872/sgn|E546468

3599

TC170666 similar to UP|Q6NLC1_ARATH (Q6NLC1) At1g54350, partial (25%)

1865

Show
Contig14448

Contig14448

 

sgn|E546428/sgn|E272160/sgn|E256069/sgn|E258980/sgn|E368862/sgn|E258977/sgn|E256171/sgn|E257943/sgn|E252111/sgn|E256151/sgn|E262955/sgn|E263638/sgn|E368861/sgn|E578165/sgn|E541397/sgn|E296040/sgn|E314649/sgn|E259055/sgn|E369858/sgn|E366872/sgn|E546468

 

3599

 

TC170666 similar to UP|Q6NLC1_ARATH (Q6NLC1) At1g54350, partial (25%)

 

1865

 

3223

 

0

 

1626

 

100

 

3599

 

AK064992|Os01g0218700 Sugar transporter superfamily protein.

 

771

 

317

 

3.00E-86

 

336

 

53

 

3599

 

ref|NP_175837.2| ATPase, coupled to transmembrane movement of substances [Arabidopsis thaliana]

 

706

 

324

 

2.00E-86

 

335

 

52

 

3599

 

SGN-U316261

 

4127

 

4510

 

0

 

2275

 

100

 

3599

 

Q55774|Y182_SYNY3 Hypothetical ABC transporter ATP-binding protein sll0182 - Synechocystis sp. (strain PCC 6803)

 

661

 

172

 

8.00E-42

 

260

 

39

 

3599

 

AT1G54350.1 | Symbol: None | ABC transporter family protein, similar to hypothetical ABC transporter ATP-binding protein GI:9955395 from (Microcystis aeruginosa) | chr1:20290549-20294068 FORWARD | Aliases: F20D21.17, F20D21_17

 

706

 

324

 

3.00E-88

 

335

 

52

 

GTTAAGGTACAGAAAATTGATAGCGTTGCCAGCTGGCTTTTGAGCTAAAGCAGAAAGTGGATGCCTTCAATTCTGGGAATGCAAAAATGATGACATTAACGATGTTAGTAATGTGGCTAAATGCTTTTAATTAGCAATTTCGGACTATTTGGTGGGGAAGTCTTATATTAAGAATCGAGAACTAGTGCTGAGGAAAATGCCTAGTAAATCAAACTTTATGCTTGTATCCAAGAAGAAATATTGAATCATTACTGGGATTGCACATATCATGGTTATGATATACTATGAAGGTAATATGGGAATACAAAAACTAAAATGTTTGAATAAAAGAAGCTAAGCTCGTACGGTCTTCAGTAGTTAATATATATAAGCTATAATTGCTTGCACTTTAAGATTCTTGAGAGAGGATGTTAAATGCTATCTCCTCTCTTGTCATATTATGTTATAAGTTCTATGACTTTTCAATCGTTTCTTACCTGAAATTTTATTTTCTTCAACTTTGTTTCTTCTTTTAGTTTCCCAGTTTTGCTATTTCCATCTAACATGACCCACTGCCCTAAAGCAGTAATAAGCATTCAGCAAACCATTTTGACACCTTTAAAAATGTGCAGGTGAATTTGATGATGTTTTGGATAGCAACAGCAAAAAAGGTGATCAAGACTCCAACGAAAAGATCCAGCTTAACTTTTGCTTAATAAGTTCTTCCAATGGGCTACACTCGAATGGATCTATGCCTCTTTCCAATCGTGTAAAATTACTTCATGTTGAACACTTGACTGTACAGACACCAAGTGAAGCAACTCTAATTAAGGACTTGTCTTTTGAGATATTTGAGAAGGATCACTTGCTGGTTACAGGACCAAGTGGAAGTGGTAAAACTTCATTGCTGAGAGTGATAGCTGGTCTTTGGAGTTTCGGGAATGGAGCAATTACAGTTTATGTCCGACCCAGAGGAGACCTGGAAATGCTGCACTCTCCAGATGTAGTTTCTCATCAAGTGGCTTCAACTAATGAGACCATAGGGGATTCCGCAGGACGTAGAAATTCCGAAGGTGTAATTTTTCTTCCTCAAAAACCATATATGGTTTTGGGAACCCTTCGACAACAGTTGTTGTATCCTACATGGACCGAAGATTCAGATAACTTGTCAGATGATGCTAAACAAACTGATTCTTTGCCATTCTTGATGCGTGCACGGGATGCAAGGTGTGTGAATGATAGATCAAAGAAGCCTACATCAGAGGATCTACTACAAGTTCTCAATGATGTATCCCTTGGACACTTGTTATCTCGTTTTGACGGCCTAGATTCAACACATGAGTGGTCGAGCGTTCTATCCCTTGGCGAGCAACAGCGCCTTGCCTTTGGCCGCTTATTGCTTTCAAAACCAACTTTGGCTCTGTTGGATGAGTCTACTAGTGCTCTTGATGAAGCCAATGAGGCACGTCTATATCAGCTAATCCAAGCTGCAGGAATCACGTATATAAGTATTGGCCACCGTAGAACCCTCTACAAATACCATAAAAAGGTCTTACACGTATCTACTGCTGATAGTACAAGTACCCAGCAGAATTGGAGCTTTAAGGACGTAGAGGAGGACCCAATATACAATTTTTCGAAGCAGTAATCATGCAAATAATTTTTTCCTTTAGTACATGATACTAATGCTTGGATGCTAATAGGATTCCACTCTGCTCATGAGGAAGTTTCCCAGAATTTCGTCTTGACTATGCTGTTACTGTATGGTCAATGTGGACTGGACTGGACATGGAAATTATTAGTGAATGCAGCACAACTTTTGAGAAGTACTTGATGAATGTGTCTCAAAATGTCATTTCAACTTTTTCATACAATTAAGAAATGTATGAAATCATATGATAACAATTTTCTGTTTTCTATGTAGTTCGTGTTCTATATGTATGTAATTATATTGATATCTGGTTAAAAGGACAGGTAGATCTAATAGAAAACAAATCTAACAGTGTGTGATATAATAATCAATGAGAAGGAGAACCATGACTGGTTAAATATAATAACTTTTGAAGGAGATTGAGAATTCTTCTAGCCAAAGAGAATGAAAGAATATGATATTCTTATTGAAAAACGACCTCTAAATCAATGGATGGTTTCCCCGTGGTGGCATGTTGTTTTGTGGATGACTGAAGGGATCCCCGAATGGGTTGGAAGATCCCATATACCAGGTTTGTTGAGAATATTGGCCTTGATATTGATGATGTACCATCGACATATTTTGTTGTGGTCGTTGCTGCTGCTGCATCATGTATTGTTGTTGTTGCATCATTTGATATTGTTGTTGTTGTTGCATCATTTGGTATTGTTGTTGTTGCTGCGCCATCATTTGTACGCTTGTTGGAGGGGCTATGTGGTTTGACATTGCAAAAGGGTCATTGTGATTGACTGAACTCTGTCCAGGTGGAACGATTGCTAGAGCCAATGCATTGCTTTCCTCTAATTCTGCAACTCTTGGATCCACTTCATTCAAGCCCTGTCCACAGAGATGAAAAATATTCTGATCAAGACTATTATTTCACACGAAAGAAGGAGACACGAGCCATGAACAAAGATTTCGTCTGTCCCCCGTGAATTCGAAATGCATACCAGCAAATCAACAGGTTCTTCTGTTGATATCAGTGGTGGTATTTCTTCCTTTTTAGGCTTTTCAGGTTTCTGCTTGGTTTCTCGATACTCCTGCAGGTCACAAAGGCAAACACTATAACCAAATCGATGAAGCTAAGTTCTCACCAGCCTGTTATATGTGACCGCATTGTATAACTACGTTCTCACCAGCCTTTTATTTGGCATTGAATCCGTTTGAGGCGCTTCTCTAATGTATTCCTCCATCGTTACCAGAAACGATGCAGGAGGCTGCAAGTTAAAGATCAAGAATGAAGAGAGATCAAAACGAAACGTAATTCATGAAGATTGTACGTTATCCAAAAGGGTGAGGAAAAAAGACCTGTTTCAATGTAGGAAACTGAAAGGTACGCGCTACATCCAAGCCTCTGCAGAAGTCATAAAAATGAGCGAGATGTTCAGCCTACATTAAGTGGAGAAAAAAAAAGAGAAGAAACTTAGATATGTTAATACCATATCTGTAAAAAGAACATGAAGTAGCAAGTTAAGTTCAAAAACAGCAATGGATAATGAGCTGGAGATATCAAAGACACGAGAGGAGCATCATACATAGTCGACAAGATTGATTATCCCATCGTTGATTGCACAATAGATCTTGAAACTTTCCTTCAACACCTACAAAAAGAACAATTAGAGCTGCAAAATTCACCAGAGAAAACGATGATAGTCAGAGAACTGGAATAACAATGAGTTTATCGCGGCTAAAACAGCAAAGGTTGTTACTACCTGGCAACCAGTTAAGCGATAAAGAAGTTGTTGTAATGCTGGGAGCTGCTCTAGAAGTTCTTCGCCATTCAAAATCCTAGTTCTACAATGCACCTGATGTGAAACTCAGGTTATCTACATTGTTTTCATTATGTATCTTACATGAAAATATGCAAATGACTAACAAAATGCACCTTGCTTATTCCAAAAAAAAAAAAAAAAAAACTCGAGGGGGGCCC

 

3599

 

37132

 

Contig7364

LC16BB01/LC05CB09/LC23AA11/LC02CA06/LC20AG10/LC12CD01/LC19BG02/LC13DD06/sgn|E363883/LC06DF12/LEFL1070DE08/sgn|E279211/LEFL1058AF06/LC19AG03/LC10BB12/LC09BD09/LC20BG05/LC02DH05/LEFL2011B06/LEFL2003BG10/LEFL2048I12/LEFL2046H04/LEFL2004D13/LEFL1097CG11/LEFL2029L20/sgn|E361756/LC03BC03/LC07BF11/LC14AA04/LC21CF01/LC06CD08/LC01BC03/LC06BB10/LEFL2010O17/LEFL1024BC05/LEFL1070BA08/LEFL1015CF03/LEFL1002DF02/LEFL1042CF04/LEFL2019G10/LEFL1026BD02/sgn|E343786/sgn|E578313/LEFL1063BB08/sgn|E334249/LEFL1027AE03/LEFL2014D20/sgn|E289623/LEFL1042AD12/sgn|E288850/sgn|E328155/sgn|E293937/sgn|E271775/sgn|E284686/LEFL2039N20/sgn|E204671/LA05CF05/sgn|E203319/LEFL1032DC02/sgn|E286130/sgn|E247021/sgn|E246357/FA27DH08/sgn|E332196/LA18CE04/LC20CA11/sgn|E366348/sgn|E313405/sgn|E278261/LB12CF10/sgn|E299046/sgn|E287109/LC03DC01/sgn|E329712/LC21AC01/LC01AC01/sgn|E296139/sgn|E297967/sgn|E226309/sgn|E226679/sgn|E366349/sgn|E246250/sgn|E282108/sgn|E203320/LC18DE06/sgn|E279035/LC14AA11/FB12BA08/sgn|E280310/LB01BG12/LC18AH09/sgn|E223698/sgn|E230208/sgn|E224039

3578

TC183648 homologue to UP|GCSP_SOLTU (O49954) Glycine dehydrogenase [decarboxylating], mitochondrial precursor (Glycine decarboxylase) (Glycine cleavage system P-protein) , partial (59%)

1839

Show
Contig7364

Contig7364

 

LC16BB01/LC05CB09/LC23AA11/LC02CA06/LC20AG10/LC12CD01/LC19BG02/LC13DD06/sgn|E363883/LC06DF12/LEFL1070DE08/sgn|E279211/LEFL1058AF06/LC19AG03/LC10BB12/LC09BD09/LC20BG05/LC02DH05/LEFL2011B06/LEFL2003BG10/LEFL2048I12/LEFL2046H04/LEFL2004D13/LEFL1097CG11/LEFL2029L20/sgn|E361756/LC03BC03/LC07BF11/LC14AA04/LC21CF01/LC06CD08/LC01BC03/LC06BB10/LEFL2010O17/LEFL1024BC05/LEFL1070BA08/LEFL1015CF03/LEFL1002DF02/LEFL1042CF04/LEFL2019G10/LEFL1026BD02/sgn|E343786/sgn|E578313/LEFL1063BB08/sgn|E334249/LEFL1027AE03/LEFL2014D20/sgn|E289623/LEFL1042AD12/sgn|E288850/sgn|E328155/sgn|E293937/sgn|E271775/sgn|E284686/LEFL2039N20/sgn|E204671/LA05CF05/sgn|E203319/LEFL1032DC02/sgn|E286130/sgn|E247021/sgn|E246357/FA27DH08/sgn|E332196/LA18CE04/LC20CA11/sgn|E366348/sgn|E313405/sgn|E278261/LB12CF10/sgn|E299046/sgn|E287109/LC03DC01/sgn|E329712/LC21AC01/LC01AC01/sgn|E296139/sgn|E297967/sgn|E226309/sgn|E226679/sgn|E366349/sgn|E246250/sgn|E282108/sgn|E203320/LC18DE06/sgn|E279035/LC14AA11/FB12BA08/sgn|E280310/LB01BG12/LC18AH09/sgn|E223698/sgn|E230208/sgn|E224039

 

3578

 

TC183648 homologue to UP|GCSP_SOLTU (O49954) Glycine dehydrogenase [decarboxylating], mitochondrial precursor (Glycine decarboxylase) (Glycine cleavage system P-protein) , partial (59%)

 

1839

 

3646

 

0

 

1839

 

100

 

3578

 

AY346327|Os01g0711400 Victorin binding protein.

 

1033

 

1635

 

0

 

1023

 

78

 

3578

 

sp|O49954|GCSP_SOLTU Glycine dehydrogenase [decarboxylating], mitochondrial precursor (Glycine decarboxylase) (Glycine cleavage system P-protein)

 

1035

 

1932

 

0

 

1025

 

94

 

3578

 

SGN-U315147

 

2662

 

5043

 

0

 

2544

 

100

 

3578

 

O49954|GCSP_SOLTU Glycine dehydrogenase [decarboxylating], mitochondrial precursor (EC 1.4.4.2) (Glycine decarboxylase) (Glycine cleavage system P-protein) - Solanum tuberosum (Potato)

 

1035

 

1932

 

0

 

1025

 

94

 

3578

 

AT4G33010.1 | Symbol: None | glycine dehydrogenase (decarboxylating), putative / glycine decarboxylase, putative / glycine cleavage system P-protein, putative, strong similarity to SP:P49361 Glycine dehydrogenase (decarboxylating) A, mitochondrial precursor (EC 1.4.4.2) {Flaveria pringlei}: contains Pfam profile PF02347: Glycine cleavage system P-protein | chr4:15926673-15931335 REVERSE | Aliases: F4I10.7

 

1037

 

1724

 

0

 

1026

 

82

 

GTGGCCTGTGTAGTATCCTCAACCCCAACAACCCATTACAACCACCCACTTTTTTTCTTTTTGTTCCATAAATAAATCAAACCATACACAATCAAATATATATAGTGAAAAACCAAAGCTTTTAGCTTTGTCAACTTTTCTCAATCTTCATCCCTTACTAGGGGTGTTTCTTGTTTTTTCCTTCACAAATCTCGAATTCAATGGAGCGTGCTAGAAAATTGGCAAACAGAGCAATTCTGAAACGTTTGGTTTCACAATCAAAACAGAGTCGTTCTAATGAAATCCCATCACCATCATCATTATACAGACCTTCAAGGTATGTATCTTCACTGTCACCATACACATTTCAGGCTAGAAATAGTGTGAAATCTTTTAATACTCAACAAGTTAGATCAATTTCTGTTGAGGCTTTGAAACCAAGTGACACATTCCCACGCCGACATAACTCAGCCACCCCTGAAGAACAAACTAAAATGGCTGAGTTTTGTGGGTTTCAAAGCCTAGATGCACTTATTGATGCTACTGTACCTCAATCGATTCGTAGTGAATCGATGAAGTTACCTAAGTTTGATGGTGGATTGACTGAGTCACAGATGATTGAGCATATGCAGAAATTGGCATCTAAGAATAAGGTTTTTAAGTCATATATTGGGATGGGGTATTATAATACTTATGTACCACCTGTTATATTGAGGAATCTTTTGGAGAATCCTGCTTGGTATACTCAGTATACTCCTTATCAGGCTGAAATTTCCCAGGGACGTCTTGAGTCCCTGCTGAATTATCAGACCATGATTACGGATCTTACTGGTTTGCCAATGTCTAATGCATCTTTACTAGATGAAGGGACCGCCGCAGCTGAGGCTATGGCTATGTGTAACAATATTCTTAAGGGAAAAAAGAAAACTTTCCTTATTGCTAACAATTGTCACCCTCAGACTATCGAGATTTGTAAGACTAGAGCTGATGGATTTGATCTTAAGGTAGTTACTGTAGATCTTAAGGATATTGATTATAAGTCTGGTGATGTTTGTGGGGTACTAGTTCAGTATCCGGGGACCGAAGGTGAAATCTTGGATTATGGGGAGTTTATTAAGAATGCACATGCTCATGGGGTGAAGGTTGTTATGGCATCTGATCTTTTGGCCTTGACAATGTTGAAACCACCTGGTGAGCTTGGAGCGGATATTGTTGTTGGTTCTGCTCAGAGGTTTGGAGTGCCTATGGGTTATGGAGGCCCTCATGCAGCTTTCTTGGCAACTTCTCAAGAATACAAGAGAATGATGCCTGGAAGAATTATTGGTCTCAGTGTTGATTCAACAGGGAAACCTGCTCTGCGTATGGCAATGCAGACTAGGGAACAACACATCCGCAGGGACAAGGCTACGAGTAACATTTGCACAGCACAGGCTTTGCTTGCCAACATGGCTGCCATGTATGCTGTCTATCATGGACCCGAGGGGCTAAAAACCATTGGCCAACGTGTTCATGGTCTTGCTGGAACATTTTCTGCTGGTCTCAAAAAGCTAGGAACAGTAGAAGTTCAGGATCTTCCATTCTTTGACACTGTGAAGGTGAAGTGTTCTGATGCAAAGGCAATTGCTGATGTTGCTACCAAGAATGACATTAACGTGCGGATTGTGGACAACAATACTATAACTGTATCTTTTGATGAAACTACTACCCTAGAAGATGTGGACGATCTATTCAAAGTTTTTGCCTTGGGAAAGCCAGTCCCGTTCACTGCTCAATCAATTGCACAAGAGGTTGAGAACCTGATTCCTTCTGGACTTACAAGGGAGACTCCATTTTTGACTCACCAAATATTCAACTCGTACCATACTGAGCACGAGTTGCTGAGATACCTCCATAAGCTGCAATCAAAGGATCTCTCCTTGTGCCATAGCATGATTCCTTTGGGCTCCTGCACAATGAAATTGAATGCCACAACAGAGATGATGCCGGTGACATGGCCTAGCTTTGCAAATATTCACCCTTTTGCACCCACTGAACAGGCAGCTGGCTATCAGGAAATGTTCGACGATTTGGGCGCCCTACTGTGTACAATAACAGGTTTTGATTCCTTCTCGTTGCAGCCTAACGCTGGTGCTGCTGGAGAATATGCTGGATTGATGGTTATTCGTGCATATCATATGTCAAGGGGTGACCATCACCGCAATGTATGCATCATTCCTGTATCAGCTCATGGAACAAATCCTGCAAGTGCTGCAATGTGTGGGATGAAAATTGTTGCTGTCGGGACAGATGCAAAAGGAAACATTAATATTGAAGAGTTGAGGAAGGCTGCTGAGGCACATAAGGATAACCTTTCTGCTCTCATGGTTACATACCCATCAACACATGGAGTGTATGAGGAAGGAATTGATGAGATATGTAAGATTATCCATGACAATGGTGGTCAGGTGTACATGGATGGAGCTAACATGAATGCACAGGTTGGTTTGACAAGCCCTGGCTTTATTGGTGCTGATGTTTGTCATCTAAATCTTCACAAAACATTCTGCATTCCTCATGGTGGAGGAGGTCCTGGAATGGGTCCAATTGGAGTGAAGAAACACTTGGCACCATATTTACCATCACACCCTGTGGTATCAACTGGAGGGATCCCATCCCCCGATCAGAGTAAGCCACTTGGTGCTATTTCTGCTGCACCCTGGGGTTCAGCACTTATTTTGCCGATTTCATATACCTACATTGCCATGATGGGGTCTAAGGGACTTACAGATGCATCAAAGATAGCTATCCTGAGCGCAAACTACATGGCGAAACGTTTGGAGAAGCACTACCCAGTCCTCTTCCGAGGTGTCAATGGAACATGTGCCCATGAGTTTATCATTGACCTGAGGGGCTTTAAGAACACTGCTGGGATAGAACCTGAAGATGTTGCTAAACGTCTTATTGACTACGGATTTCATGGACCTACAATGTCTTGGCCAGTTCCTGGTACACTTATGATTGAACCTACTGAAAGTGAAAGCAAGGCGGAACTAGACAGGTTTTGTGATGCACTCATCTCCATCAGAGAAGAAATCGCTCAGATTGAGAAAGGGAATGTCGATATTAACAACAATGTTCTCAAGGGGGCTCCTCATCCACCATCAATGCTCATGGCAGATGCATGGACAAAGCCATATTCTCGGGAATATGCTGCATACCCTGCTCCCTGGCTAAGGAGTGCCAAATTCTGGCCAACTACAGGACGAGTGGACAATGTGTATGGAGATCGCAACCTGATCTGCACCCTTCTTCCAGTGTCAGAAATGGCGGAAGAAAAAGCTGCAACTGCTTAAGCGTCAACTGTTTCAGTGGTCATAAGTTCCTTTACAAAGCATGAAATCACTTTCCTCGTCGATGATCTTGTTGTACATACAAGTTTCATATTCATATACTTGGTGGTAGCTGATGACTTCCATCTTCTTGCCATATTGATGAAAAGCTGCTATATTAACAGATCATGTTGATCATTGCAGCTCACTTGTTGTAATCATCAATTCCTTCTTTCTTCAATCTATCTATCTTTCATCAACAAAAAAACATAAAAAAAAAAAAAAAAAAAA

 

3578

 

30048

 

Contig6528

LEFL1095AG05/sgn|E334569/sgn|E334465/sgn|E207359/sgn|E274363/sgn|E247124/sgn|E210562/sgn|E274365/sgn|E208405/sgn|E208707/sgn|E301651/sgn|E273140/sgn|E204244/sgn|E272269/sgn|E270738/sgn|E370211/sgn|E268833/sgn|E205312/sgn|E269628/sgn|E251915/sgn|E325248/sgn|E250098/sgn|E246085/sgn|E370210/sgn|E398055

3564

TC187359 similar to UP|DEGP7_ARATH (Q8RY22) Protease Do-like 7 , partial (76%)

3163

Show
Contig6528

Contig6528

 

LEFL1095AG05/sgn|E334569/sgn|E334465/sgn|E207359/sgn|E274363/sgn|E247124/sgn|E210562/sgn|E274365/sgn|E208405/sgn|E208707/sgn|E301651/sgn|E273140/sgn|E204244/sgn|E272269/sgn|E270738/sgn|E370211/sgn|E268833/sgn|E205312/sgn|E269628/sgn|E251915/sgn|E325248/sgn|E250098/sgn|E246085/sgn|E370210/sgn|E398055

 

3564

 

TC187359 similar to UP|DEGP7_ARATH (Q8RY22) Protease Do-like 7 , partial (76%)

 

3163

 

6199

 

0

 

3163

 

99

 

3564

 

AK065045|Os02g0712000 PDZ/DHR/GLGF domain containing protein.

 

914

 

1098

 

0

 

800

 

68

 

3564

 

ref|NP_001047905.1| Os02g0712000 [Oryza sativa (japonica cultivar-group)]

 

914

 

1098

 

0

 

800

 

68

 

3564

 

SGN-U316157

 

3235

 

6284

 

0

 

3170

 

100

 

3564

 

Q8RY22|DEGP7_ARATH Protease Do-like 7 (EC 3.4.21.-) - Arabidopsis thaliana (Mouse-ear cress)

 

1097

 

1062

 

0

 

794

 

66

 

3564

 

AT3G03380.1 | Symbol: None | DegP protease, putative, contains similarity to degP GI:2623992 from (Bradyrhizobium japonicum) | chr3:799622-808529 FORWARD | Aliases: T21P5.20, T21P5_20, AT3G03390

 

1097

 

1062

 

0

 

794

 

66

 

AAATTCACTATCCGTCAATCGTGATCGGAGATTTTGATGTCGGAGATAGTAGTAGAAGAGGAATCTATAATAATGGAGAATTTGTGTATGGATATTGATCCTCCGTTCAAGGAGAACCTCGCTACTGCTGAAGATTGGCGGAAGGCTCTTAGCAAAGTAGTTCCTGCTGTCGTCGTACTCCGAACTACTGCTTGCCGAACATTCGACACTGAATCTGCTGGTTGCAGCTCCGCAACGGGTTTTGTTGTTGATAAGCGTCGCGGAATTATACTCACGAATCGACATGTTGTTAAACCTGGACCTGTGATGGCGGAGGCTATGTTTGTGAACCGTGAAGAAATACCAGTTTACCCCATATACAGGGACCCTGTTCATGATTTTGGCTTCTTTCGGTATGACCCTGGTGCAATACAATTTTTGAGCTATGAAGAGATTCCTCTTGCTCCTGATGCAGCCTCTGTAGGTGTAGAAATTAGGGTTGTTGGTAATGACAGTGGAGAGAAGGTGTCTATTTTGGCGGGTACCCTTGCTCGATTAGATAGAGATGCTCCGCAGTATAAAAAAGACGGCTACAATGACTTCAACACATTCTACATGCAAGCTGCTTCGGGGACTAAAGGTGGTTCAAGTGGCTCACCTGTAATTGATTGGCAAGGAAGAGCTGTTGCCTTGAATGCTGGGAGCAAGTTATCAAGTGCATCTGCTTTTTTCTTGCCTTTAGAACGAGTTGTCAGGTCACTCAAGTTCTTACAGGAAGGAGGATATCATTCTACTAATACATGGGCAGCGGTCACGATTCCTCGTGGTACACTTCAGGTGACCTTTCTCCATAAAGGCTTTGATGAGACACGCAGGCTTGGAGTTCAACGTGAGACAGAACAGTTGGTGCGCAATTCAACTCCACCCTCTGAAACTGGAATGCTTGTTATCGATTCCGTGGTTCCTGGTGGCCCGGCTCATATCAATTAGAGCCCGGTGATGTGCTTGTTCGCATGAATGGGGAGATTGTTACCCAGTTCCTGAAGATGGAGACTTTACTCGATGATAGTGTTGAGCAGAAAATTGAGCTTCAAATTGAAAGGGGTGGCACTCCCTTGACAGTGGACTTGTTGGTTCAGGATTTGCACTCAATAACTCCTGACCACTTCTTGGAAGTTGGCGGTGCAGTGATACACGCCCTTTCTTATCAACAGGCTAGAAATTTTCGTTTTAATTGTGGTCTTGTCTATGTCTCTGAACAAGGATACATGCTATCTAGAGCAGGAGTTCCTCGCCACTCCATCATTAAAAAATTTGCAGGGGAAGGTATTTCAAGGCTTGAAGAATTAATTTCCGTTTTATCTAAGTTGTCTAGGGGTGCAAGAGTACCATTGGAGTATATACACTACAAGCAACGACATCAGAGAAAGTCTGTCTTGGTTACAATTGACCGCCATGAGTGGTATGCACCACCACAGATATATAAGCGTAATGACAGATCTGGCTTATGGACAGTAAAACTGGCTTTGCAGCAGGAATCCCCACTCTTGGTATCTGGCATTTATCCAGTCGAAAATCATGCTGAGTCTTGTACTAGCGAGGTCAGTCCTAAGGACTATAGACCTGAACAAGTCAGCCAAGAATCCACAGATGGACTTACTAGTATGGAAATTAGTGGTGAACTTGTTGCTGAGGGACCAAATGCTCAGGATGATTCTGATAATGGAACAAAGAAAGGGCGGGTGGAAGAGAACTCATCAGAAGACGGCAGTGTAGTGGCCGATTGTTCTTTAAATGAGTGTAGAGAAGAAAGATTGAATGAGTCTGAATCTGTGGAAAATGCAGTTCTGAGAGATTATCATGTTGCCGCACCTGTAGAAGCTACATCAGTCGCTGAGCGTGTGATCGAACCTACTCTTGTGATGTTTGAGGTTCATGTCCCTTCATCATGTATGCTTGACGGTGTTCTCTCGCAACAGTTTTTTGGAACTGGGGTAATTGTATATCATTCCCAAACAATGGGCTTGGTTGCTGTTGACAAAAACACAGTTGCAGTACCAGTTTCTGATGTGATGTTATCATTTGCTGCTTTTCCAATTGAAATTCCTGCTCAGGTAGTTTTCCTCCATCCTTTCCATAATTTTGCTCTGGTTGCTTACGATCCCTCTGCTCTGGGAGCTGCTGCAGCCTCCGTGGTTCGTGCTGCTGAACTTCTTCCTGAACCTGCTCTTCGTCGTGGAGATTCAGTGTTTCTAGTGGGATTGAGTAGAAGCCTGCAGGCAACCTCAAGGAAATCAATCGTGACTAATCCTTCTGCTGCTGTGAATATTGGATCCTCTGATGTTCCACGGTACAGAGCAACAAACATGGAGGTCATTGAGCTGGACACTGATTTTGGAAGCACCTTTTCTGGTGTGCTGACTGATGAGTGTGGAAGGGTTCAAGCTTTATGGGGAAGCTTTTCAACACAGCTCAAGTATGGCTCAAGTTCATCAGAAGAGCACCAATTTGTCCGAGGTATCCCAATATATAAAATAAGCCAACTCGTTGACAGGATTACTTCTGGCACTGAGGGACTGCCTCGTCTTATAAATGGTTTGCGAAGACCTATGCCTTGCATAAGGATATTAGAAGTTGAACTTTACCCTACTTTGCTATCTAAAGCTCGAAGTTTTGGATTAAGTGATGCATGGATCCAGGCCCTCGTGAAGAAGGATCCTCTGAGACGCCAAGTTTTGCGAGTCAAAGGTTGCTTTGCTGGGTCAAAAACTGAAAACTTGTTGGAACAAGGGGACATGGTCTTAGCAATTAATAAGCAGCCAGTTACATGCTTTCGTGACATTGAAGATGCATGCCAATCTTTAGACCATTGCACTCAGGATGATGGAAAACTAGACTTGACAATTTTCCGTCAGGGAAAAGAAATTGAACTACTTGTGGGAACGGATGTGAGGGATGGAAATGGAGCCAAACGAGCAATAAATTGGTGTGGCGGTATCCTCCAAGAACCTTATCCAGCCGTACGTGCACTTGGGTTTCTGCCTGAAGAAGGCCATGGAGTGTATGTGGCAAGGTGGTGTCATGGGAGTCCTGCACATCGTCATGGTCTCTTTGCTCTTCAATGGATAGTTGAAGTCAACGGGAAACCAACCCCTAACTTGGATGCTTTTGTCGATGTGACTAAGACAATAGAGCATGGAGAGTTTGTTCGTGTACGAACAATCCACCTGAATGGGAAACCTCGAGTGCTCACATTGAAGCAAGATTTACATTACTGGCCAACATGGGAACTCAGGTTTGATCCTGAAACTGCAATGTGGCGACGCAAAGTAATTAAATCATTGGATTCTGATGTTCTGTGAACTGTTTCACCAGATTGTTCGAAGCATTTATCCTACTCATTAGTTGGTATTTGAACTTCTCATGTGTAGCTAGCTGTACGAGAATCTTAATAAACTGAAGGTATATTGATTTGATGCCTATATGATGTGAAATAATTAGATATTTGATCTTTTTTTAAAAAAAAAAAAAATTGTATGAACAGTTGATTTTGACAAAAAGAGGAAATTTCTTTAAAAAAAAAAA

 

3564

 

29212

 

Contig6563

LEFL1095DD08/LEFL1093BB07/LEFL1094AD10/LEFL1079AA02/sgn|E365880/sgn|E282554/LC02CB05/sgn|E366530/LEFL1004AF08/sgn|E548230/LEFL1058DB03/LEFL1004CA02/LEFL1089BB05/LEFL1079CD02/sgn|E326129/sgn|E316446/sgn|E336776/sgn|E206525/sgn|E209698/sgn|E265061/sgn|E265177/sgn|E265351/sgn|E289467/sgn|E271043/sgn|E209878/sgn|E364733/sgn|E265878/sgn|E265885/sgn|E212399/sgn|E366625/sgn|E253753/sgn|E287907/sgn|E266139/sgn|E303775/sgn|E307393/sgn|E247351/sgn|E269401/sgn|E245553/sgn|E268163/sgn|E269745/sgn|E556434/sgn|E290734/sgn|E206415/LC19BC09/sgn|E242386/sgn|E395963/sgn|E539494/sgn|E344266/sgn|E282770/sgn|E310203/sgn|E237473/sgn|E231491/sgn|E244651/sgn|E228392/sgn|E247229

3517

TC171686 UP|Q84NI5_LYCPN (Q84NI5) Aconitase (Fragment) , partial (97%)

2877

Show
Contig6563

Contig6563

 

LEFL1095DD08/LEFL1093BB07/LEFL1094AD10/LEFL1079AA02/sgn|E365880/sgn|E282554/LC02CB05/sgn|E366530/LEFL1004AF08/sgn|E548230/LEFL1058DB03/LEFL1004CA02/LEFL1089BB05/LEFL1079CD02/sgn|E326129/sgn|E316446/sgn|E336776/sgn|E206525/sgn|E209698/sgn|E265061/sgn|E265177/sgn|E265351/sgn|E289467/sgn|E271043/sgn|E209878/sgn|E364733/sgn|E265878/sgn|E265885/sgn|E212399/sgn|E366625/sgn|E253753/sgn|E287907/sgn|E266139/sgn|E303775/sgn|E307393/sgn|E247351/sgn|E269401/sgn|E245553/sgn|E268163/sgn|E269745/sgn|E556434/sgn|E290734/sgn|E206415/LC19BC09/sgn|E242386/sgn|E395963/sgn|E539494/sgn|E344266/sgn|E282770/sgn|E310203/sgn|E237473/sgn|E231491/sgn|E244651/sgn|E228392/sgn|E247229

 

3517

 

TC171686 UP|Q84NI5_LYCPN (Q84NI5) Aconitase (Fragment) , partial (97%)

 

2877

 

5646

 

0

 

2872

 

99

 

3517

 

AK067183|Os03g0136900 Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).

 

986

 

1531

 

0

 

983

 

78

 

3517

 

gb|AAP30039.1| aconitase [Lycopersicon pennellii]

 

898

 

1758

 

0

 

897

 

97

 

3517

 

SGN-U312610

 

3498

 

6706

 

0

 

3458

 

99

 

3517

 

P49608|ACOC_CUCMA Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase) - Cucurbita maxima (Pumpkin) (Winter squash)

 

898

 

1638

 

0

 

898

 

89

 

3517

 

AT2G05710.1 | Symbol: None | aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative, nearly identical to SP:P49608 Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase) {Cucurbita maxima}: contains Pfam profiles PF00330: Aconitase family (aconitate hydratase), PF00694: Aconitase C-terminal domain | chr2:2141396-2146675 FORWARD | Aliases: T3P4.5, T3P4_5

 

990

 

1622

 

0

 

933

 

85

 

ATTTAGCCAAGCTTTTTTTATTTTAGCTCCATTTGATGTGCCGCAGCTTCGGCACTGTCCTTTACCATATCAGTAATCAATAATTCAAATCGCCATATCTTCTTCGTCACTATCTTCATCTTCTTCCTCATCAGCAATTTCCCTTTTTTTGTTTGGGCACACAACCCTAGGAGGTTACCATTGAATGTGATTTGAGAAAAAAAAAACTATATATATACATATTGGGAGTCATGTATAGTAATACAGCTCGCAAGTACTCTTCTTCTGCTGCTTCTTCATTATTGAGAGCATCTTCTTCTGTTACAAGGCCGCTTGCTTCAACTTCTACTGCTGCTCACGCGCCTTGTCGTGCTGGTGCTGCTTCTGGTAATCAGCAGCGTTATTCATCAACGCTTCGGTCTCTGCGTTGCTCTGTGCCGAGGTGGAGTCACGGTGTTGATTGGAAGTCTCCGATCAGTCTTACTGCTCAGATCAGGACTGCTGCCCCTGCTCTCAACGGGTTTCATCGGAAACTAGCTACCATGGCTGCAGAGAACCCATTTAAGGGAATCCTCACTGGTCTTCCAAAGCCCGGAGGTGGTGAATTCGGAAAGTTCTATAGCTTACCTGCGCTCAATGATCCCAGGATTGACAAGCTACCATACTCTATCAGAATTCTTCTCGAATCAGCAATCCGTAATTGTGACAACTTTCAAGTGAAAAAGGAAGATGTTGAGAAGATTATTGACTGGGAAAATTCTGCACCTAAGCTTGTGGAGATACCCTTCAAGCCTGCCCGTGTCTTGCTGCAGGATTTTACTGGTGTACCAGCTGTGGTGGACCTTGCTTGCATGCGTGATGCCATGAACAACCTTGGCAGTGATTCTGACAAGATTAATCCATTGGTTCCTGTCGACCTAGTTATTGATCACTCAGTTCAAGTTGATGTAACAAGGTCAGAAAATGCAGTCCAGGCTAATATGGAGCTTGAATTCCAAAGGAATAAGGAGAGATTTGCCTTCCTTAAGTGGGGATCCAATGCTTTCCAAAACATGCTTGTTGTTCCACCTGGGTCTGGTATTGTGCATCAGGTGAATCTTGAATATCTTGGAAGGGTTGTGTTCAATAGGGAAGGCTTGCTCTACCCAGATAGCGTGGTCGGAACAGATTCCCACACCACTATGATTGATGGGTTAGGAGTTGCTGGCTGGGGTGTCGGAGGTATTGAGGCAGAAGCTGCAATGCTTGGCCAGCCAATGAGCATGGTGTTGCCTGGAGTTGTCGGGTTCAAGCTATCAGGGAATTTGCGAAATGGTGTAACTGCCACTGACTTGGTTCTGACTGTCACTCAAATGCTGAGGAAGCATGGTGTTGTTGGAAAGTTTGTTGAATTCTATGGTGAGGGAATGAGTGGTCTTTCATTGGCTGACAGGGCCACCATTGCAAACATGGCTCCTGAATATGGTGCAACAATGGGTTTCTTCCCTGTAGATCATGTTACTTTGCAATACCTCAAGTTAACAGGGAGAAGTGATGAAACAGTTGGAATGGTAGAGTCATATCTCCGTGCAAATAATATGTTTGTCGATTATAAAGAGCCTCAACAAGAAAAGGTGTACTCTTCTTATTTGAACTTAGACCTTGCCGATGTTGAACCATGTCTGTCAGGGCCAAAGAGACCTCATGACCGTGTGCCTTTGAAAGAAATGAAGTCTGACTGGCATGCTTGCCTAGATAACAAAGTTGGATTCAAGGGATTTGCTGTGCCAAAAGAGGTGCAAGATAAAGTGGCCAAGTTTTCCTTCCATGGGCAACCTGCAGAGCTCAAACATGGCAGTGTTGTGATTGCTGCTATCACAAGTTGCACAAATACATCCAATCCCAGTGTTATGCTAGGAGCAGCTCTGGTTGCCAAAAAGGCATCTGAGCTGGGTCTACATGTTAAGCCATGGGTTAAAACTAGCCTTGCCCCAGGCTCTGGTGTTGTTACAAAATATTTACTCAAGAGTGGTCTACAGAAGTATTTAAATCAGCAAGGTTTCAACATTGTTGGCTATGGCTGCACCACTTGTATAGGGAACTCTGGGGACTTGGATGAATCTGTTGCTTCTGCCATATCAGAGAACGACATTGTTGCTGCTGCTGTACTCTCCGGAAATCGGAACTTTGAGGGGCGTGTTCATGCCCTGACAAGAGCAAACTATCTTGCTTCACCTCCCTTGGTGGTTGCCTATGCTCTTGCTGGCACTGTTGATATAGACTTTGAGAAAGATCCAATTGGAGTGGGGAAGGATGGTAAGGATGTGTACTTCAGGGATATATGGCCATCAACTGAAGAAATTGCTGAGGTTGTTCAATCAAGTGTATTGCCAGACATGTTCAAGAGTACATATGAAGCTATCACAAAGGGAAATACCATGTGGAATGAATTATCTGTGCCAACAACAAAGCTGTACCAATGGGATCCTAAATCTACATACATCCATGAGCCACCATATTTCAAGGGTATGACCATGGATCCTCCTGGACCTCATGGAGTGAAGGATGCTTACTGCTTGCTGAACTTTGGCGACAGTATTACTACTGATCACATTTCACCTGCTGGAAGCATTCATAAAGATAGCCCTGCTGCTAGGTACCTTATGGAGCGGGGTGTCGATCGCAGGGACTTCAACTCATATGGTAGCCGTCGTGGTAATGATGAGATTATGGCTAGGGGTACTTTCGCCAATATCCGCCTTGTAAACAAGCTGTTAAACGGGGAGGTTGGTCCAAAGACGGTCCACATTCCTTCTGGAGAAAAGCTATCTGTGTTTGATGCTGCTATGAAATACAAATCCGCTGGACAAAGCACTATTATCTTGGCTGGAGCTGAATATGGAAGTGGAAGCTCCCGAGATTGGGCTGCCAAGGGACCAATGTTGTTGGGAGTTAAAGCTGTAATTGCTAAGAGCTTCGAGAGGATTCATCGCAGTAACTTGGTAGGAATGGGTATTGTGCCTCTATGTTTTAAGGCTGGGGAGGATGCAGATACACTTGGATTGACAGGTCAAGAGCGCTATACCATTGATCTTCCTGAAAATATTAGTGAGATCCGCCCTGGGCAAGACGTTACTGTACAAACAGATACTGGAAAATCCTTCACCTGCGTAGTGCGGTTCGACACTGAGGTGGAGTTGGCTTATTTCAACCATGGAGGTATTCTTCAATATGTCATTCGTCAATTGACAAAGCAATGAGGATCGCTATGATTATTTGGCCACGTTTACAAAGCTGCCCGCTTAATTGTGGGAAGATGACAGAGCGTAAAGAGAGAGATCTTCTTCTCAATAGAGCAACTTGAGAAGGGAATAAATGATTTTAAAACTTTTTTATGTCCCTTTTGTTGGACAAAGTGTTGTTTATTTACTTCTAAAGGCACTGTCAAGCTAGTCTTTTTCCTGCGGATAGCATTATACCATTTTTTTTGGTAATAAAATTTAAATTGAGATTCTCTTCAAAAAAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTC

 

3517

 

29247

 

Contig9194

LEFL1003DF10/sgn|E319450/LEFL2028E07/LEFL2040H04/LEFL2035E02/sgn|E314236/sgn|E328465/sgn|E301527/sgn|E370477/sgn|E272005/sgn|E317446/sgn|E347688/sgn|E261660/sgn|E343546/sgn|E339272/sgn|E325868/sgn|E268882/sgn|E323952/sgn|E268763/sgn|E272205/sgn|E289213/sgn|E214414

3496

TC185991 similar to UP|Q84XI2_GOSHI (Q84XI2) Glycosyl hydrolase, partial (73%)

2963

Show
Contig9194

Contig9194

 

LEFL1003DF10/sgn|E319450/LEFL2028E07/LEFL2040H04/LEFL2035E02/sgn|E314236/sgn|E328465/sgn|E301527/sgn|E370477/sgn|E272005/sgn|E317446/sgn|E347688/sgn|E261660/sgn|E343546/sgn|E339272/sgn|E325868/sgn|E268882/sgn|E323952/sgn|E268763/sgn|E272205/sgn|E289213/sgn|E214414

 

3496

 

TC185991 similar to UP|Q84XI2_GOSHI (Q84XI2) Glycosyl hydrolase, partial (73%)

 

2963

 

5640

 

0

 

2923

 

99

 

3496

 

AK119412|Os05g0391500 Glycosyl hydrolase.

 

984

 

1088

 

0

 

767

 

66

 

3496

 

gb|AAO27794.1| glycosyl hydrolase [Gossypium hirsutum]

 

976

 

1207

 

0

 

768

 

74

 

3496

 

SGN-U318241

 

2117

 

4155

 

0

 

2117

 

99

 

3496

 

Q5H7P5|EBM_LILLO Mannosylglycoprotein endo-beta-mannosidase (EC 3.2.1.152) (Endo-beta-mannosidase) [Contains: Mannosylglycoprotein endo-beta-mannosidase 31 kDa subunit: Mannosylglycoprotein endo-beta-mannosidase 28 kDa subunit: Mannosylglycoprotein endo-beta-mannosidase 42 kDa subunit] - Lilium longiflorum (Trumpet lily)

 

953

 

1077

 

0

 

769

 

68

 

3496

 

AT1G09010.1 | Symbol: None | glycoside hydrolase family 2 protein, low similarity to mannosidase (gi:5359712) from Cellulomonas fimi | chr1:2895169-2899385 REVERSE | Aliases: F7G19.12, F7G19_12

 

944

 

1055

 

0

 

770

 

66

 

GAAGAAGAAGCTCTTCCATAAAGTAGTAGCAGCAGTGATGATCATCTCTCATTGTGTTGTGTGTTGATAAAAGAGGAGATTAAGGTTGTTCTTTTAGGGTTTTCTTGAATGGTGAAGACAGTGTTGGATAAAGGGTGGTTAGCTGCCCGATCCACTGAAGTTGAAATCAATGGAGTACAGCTCACTACTACTCAACCTCCAACACAACCTCTTAATTCTCCTTGGATGGAAGCTTCTGTTCCCGGAACTGTTTTAGGAACTCTGCTAAAAAACAAGCTTATTCCTGATCCTTTCTATGGGTTGGAAAATGAAGCAATTATTGACATTGCGGATTCAGGGAGGGAACACTACACTTTCTGGTTTTTCACTACCTTTGAATGTAAGCTGTCGAATAATCAACACGTGGATCTTAATTTTCGGGCAATTAACTATTCTGCTGAAGTCTATCTGAATGGGCACAAGGAGGTGCTTCCAAAAGGAATGTTTAGGAGGCATTCTATTGATATTACTGACATTTTGCATCCGGATGGTCAGAATCTGCTGGCTGTGCTTGTCTATCCTCCTGATCATCCAGGGCGTATTCCTCCTAAGGGTGGTCAAGGTGGTGATCATGAGATTGGGAAAGATGTTGCTGCACAATATGTCGAAGGTTGGGATTGGATGACTCCAATAAGGGATAGGAACACTGGCATCTGGGATGAGGTATCCATTACTGTGACAGGGTGAAACTAGTAGATCCCCACTTGGCGTCATCTTTTTTTGACGGCTACAAGAGGGTATATTTGCATTCTACGGTCGAGTTGGTCAACAGAAATGCCTTGGTAGCTGAATGCTCGCTGAACATCCAAGTGTCAACTGAACTTGAAGATGGTACTTTCTTAGTTGAGCATCTTGAGACACAGCATGTGTCTATTTCTGCGGGTGCAAACATTCATTATACATTTCCTCAACTTTATTTATATAAACCCAATTTATGGTGGCCTAATGGCATGGGTAAGCAACATCTGTACAATGTCGAGATAACTGTTAATGTGAAAGGTTATGGAGAATCGGATACATGGAGTCATCATTTTGGCTTTCGCAAAATTGAGAGTCATATAGATAGTGCCACAGGTGGAAGGCTTTTTAAGGTAAATGGTCAGCCAATATTCATTCGTGGGGGCAATTGGATCCTCTCAGATGGATTATTGCGGCTTTCAAAGGAAAGATACAAGACGGATATCAGATTCCATGCTGATATGAACTTCAACATGATGCGTTGTTGGGGTGGGGGACTGGCTGAGAGACCTGAGTTTTATTATTATTGTGACTTGTATGGTTTACTGGTTTGGCAAGAGTTCTGGATTACCGGGGACTGTGATGGACGAGGTGACCCTGTGTCAAACCCAGATGGCCCACTTGACCATGATCTTTTCTTGCTATGTGCAAGAGATACAATTAAGCTTTTGAGGAACCATCCTAGTCTTGCCTTGTGGGTTGGGGGAAATGAACAAGTTCCACCACCTGACATCAATGCTGCTTTGAAGAATGATCTACAACTCCATCCATATTATATGAATTTAAATAACAATGGCACATCAACAATTACTCCCCTGATAAAGGATCCAAGTCAATATCTAGATGGTACTAGAGTTTATGTTCAAGGATCTATGTGGGATGGATTTGCAGATGGGAAAGGGGAGTTCACCGATGGTCCTTACGAAATTCAGAACCCCGAGGACTTCTTCAAGCATGACTACTACCAGTATGGCTTTAATCCAGAGGTCGGTAACGTGGGGATGCCAGTAGCGGCTACTATCAGGGCAACTATGCCTCCAGAAGGGTGGCAGATTCCTCTGTTCAAAAAATTATCAAATGGCTACATTGAAGAAGTCCCCAATCCCATATGGACTTATCATAAATACATTCCCTATTCCAAACCAGAGAAGGTTCATGACCAGATATTATCATATGGGAAACCAAATGATCTGGATGATTTTTGTCTGAAGGCACAGCTTGTTAACTATGTTCAGTACAGAGCTCTTTTAGAAGGCTACACTTCCCAGATGTGGAGCAAATATACAGGTGTTTTGATATGGAAAACTCAAAACCCATGGACTGGTCTAAGAGGCCAGTTTTATGATCATCTCCTTGACCAAACAGCAGGATTCTATGGCTGCCGCTCTGCGGCAGAACCAATTCATGTTCAGCTTAATCTGGCAACATATTCTGTTGAGGTAGTGAACACTACGTCAGAGGAACTTTCTAACGTTGCTATAGAAACCTCAGTTTGGGATTTGGAAGGCGAATGTCCATACTACAAAACCTCTGAAAAACTTACTGTGCCACCCAAAAAAACTATATCTACGTTTGAGATGAAGTATCCAAAGTCAAAGAATCCAAAGCCAGTTTACTTTCTTCTTCTCAAACTCTATGATGTGTCTGATAATCGCATATACTCGAGGAATTTTTACTGGTTGCACCTAACCGGTGGTGATTACAAGCTTTTGGAACAATTCAGGGAGAGAAGACCACCCCTCAAGATAACTTCTCTAACCTTTATAAAAGGGTCGAGCTATGAAATGCGCATGCATATTCAGAACACATCAAAGAAGCCAGATTCTAACGCTCCACTGTATAGAAATAACTTTATCAGAAGAAACGGCAGCTTTGATGAATCGGATTCATCAGAATCTTTTGACCTTTTGGATGGGGAGAAACATGAAATCAGTTTATACGAGAAGATTAGGAGGAACTTTTCAAGGGGTCACAACAAGGCGAAGGTTTCTGAAGTTAATGGAACGGGGAAAGGAGTTGCTTTCTTTCTTCATTTCTCTGTTCATGCTTCAAAGGAGGAAAACAAGAAAGGTGAAGAAGACACACGCATCCTTCCTATTCATTACTCCAACAACTATTTTTCACTGGTACCAGGTGAAGTGATGACAGTAACCATTTCCTTCGAAGTACCTCCTGGTGTCACTCCTCGGGTCACACTGCATGGCTGGAACCACCATGATGTGCACACCGTACTTTAAGTCAGTCATCTCCTTGCTCCAGTTTGTTTACAGGTGTTGTTGTACAATAGTAGTATTTCATGTCATCGTTAGTTCTGGATGTCAAAATGTTCACTCTTTTGGTGCTTTGTACTGAAGTTTATCCTTTAATACTGTAAACGTAGTTGACTCTGAGGAAAGAGTCTGGAAATAAGAGCTCTAATGCTTGTCGGTAACAGCCCAGCTGTGCACCATAGGAGTTTCTGACACTCATGTCATTTTGATCAATAAAATCGTTTTAATTTCCATTTAATGCTATGTGCATGACTACTCCTACCTGTGGAACTGCATTTTTGATAGTTTGTCAAACATAGTCAAATAATATTGAAAATACAAAAAAGTTCCTCAAGTCTTGGCTCAAGAAAAACAGACAAGAATGGAACAATTAGAGAGTTGGTCACCTAAACAAGAAATTAGCAGTATGCTCATCTCACTCAACATAACATAAACATAATGTAGCAGTT

 

3496

 

31878

 

Contig20404

LEFL1087AC05/LC13AB05/sgn|E246261/sgn|E369110/LEFL2032O02/sgn|E328895/sgn|E208773/LEFL2037N09/sgn|E337224/sgn|E244837/sgn|E263874/sgn|E208836/sgn|E262650/sgn|E257665/sgn|E251041/sgn|E261022/FA16DG05/sgn|E239809/sgn|E228475/LA16DA12/sgn|E251357/FA11AD11/sgn|E369109/sgn|E369182/sgn|E246213/sgn|E552604/sgn|E556115/sgn|E552724/sgn|E552606/sgn|E552725/sgn|E557029

3459

TC180394 homologue to UP|O04864_SOLTU (O04864) 1,4-alpha-glucan branching enzyme (Fragment) , partial (46%)

1382

Show
Contig20404

Contig20404

 

LEFL1087AC05/LC13AB05/sgn|E246261/sgn|E369110/LEFL2032O02/sgn|E328895/sgn|E208773/LEFL2037N09/sgn|E337224/sgn|E244837/sgn|E263874/sgn|E208836/sgn|E262650/sgn|E257665/sgn|E251041/sgn|E261022/FA16DG05/sgn|E239809/sgn|E228475/LA16DA12/sgn|E251357/FA11AD11/sgn|E369109/sgn|E369182/sgn|E246213/sgn|E552604/sgn|E556115/sgn|E552724/sgn|E552606/sgn|E552725/sgn|E557029

 

3459

 

TC180394 homologue to UP|O04864_SOLTU (O04864) 1,4-alpha-glucan branching enzyme (Fragment) , partial (46%)

 

1382

 

2708

 

0

 

1381

 

99

 

3459

 

AK068920|Os06g0726400 Branching enzyme-I precursor (Starch-branching enzyme I).

 

776

 

1163

 

0

 

720

 

74

 

3459

 

emb|CAA70038.1| 1,4-alpha-glucan branching enzyme [Solanum tuberosum]

 

830

 

1493

 

0

 

806

 

90

 

3459

 

SGN-U312427

 

3466

 

5031

 

0

 

2618

 

99

 

3459

 

P30924|GLGB_SOLTU 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enzyme) - Solanum tuberosum (Potato)

 

861

 

1474

 

0

 

759

 

93

 

3459

 

AT2G36390.1 | Symbol: None | 1,4-alpha-glucan branching enzyme / starch branching enzyme class II (SBE2-1), nearly identical to starch branching enzyme class II (Arabidopsis thaliana) GI:619939 | chr2:15271316-15277164 FORWARD | Aliases: F1O11.2, F1O11_2

 

858

 

818

 

0

 

695

 

57

 

AAGGCGAAAGCTGAAGCAAAGTAGCATAATTTGATCAATGGAAATTAATTTCAATGTTTTATCAAAACCCATTCGAGGATCTTTTCCATTTTCCTCACCTAGAGTTTCTCCACGGGCTTCTAGAACTAAGATATGTTTTCCTTCTCAACATAGTACTGGACTGAAGTTCGGATCTGAGGGACGGTCTTGGGATATTTCTAGCACCCCAAAATCAAGAGTTAGAAAAGATGAAAGGATGAAGCACAGCTCAGCTATTTCCGCTGTTTTGACCAATGATAACTCGACAATGGCATCCAGAGAGGAAGATGTCAAGACTGAAAATATTGGCCTCCTAAATTTGGATCCAGCTTTGGAACCTTATCTAGATCACTTCAGATACAGAATGAAGAGATATGTGGATCAGAAAATGCTCATTCAAAAATATGAGGGAGGCCTTGAGGAATTTGCTCAAGGTTATTTAAAATTTGGATTCAACAGGGAAGATGGTTGCATAGTCTATCGTGAATGGGCTCCTGCTGCTCAGGAAGCAGAAGTTATTGGTGATTTCAACGGATGGAACGGTTCCAACCACATGATGGAGAAGGACCAGTTTGGTGTTTGGAGTATTAGAATTCCTGATGTTGACAGTAAGCCAGCCATTCCACACAACTCCAGAGTTAAGTTCCGTTTCAAGCATGGCGAGGGAGCGTGGGTAGATCGTATCCCTGCTTGGATAAAGTATGCCACTGTAGACGCCACAAAGTTTGCAGCACCATATGATGGTGTCTACTGGGACCCACCGCCTTCTGAAAGGTACAACTTCAAATACCCTCGCCCTTCCAAACCCCGAGCCCCACGAATCTACGAAGCACATGTCGGCATGAGCAGCTCAGAGCCACGTGTAAATTCGTATCGTGAGTTTGCAGATGATGTTTTACCTCGAATTAAGGCAAATAACTATAATACTGTCCAGTTGATGGCCATAATGGAACATTCTTACTATGGATCATTTGGGTATCATGTTACAAACTTTTTTGCTGTGAGCAGTAGATCTGGAAATCCGGAGGACCTAAAGTATCTGATAGATAAAGCACATAGCTTGGGTTTACAGGTTCTGGTGGATGTAGTTCACAGTCATGCAAGCAATAATGTCACTGATGGCCTCAATGGCTTTGATATTGGCCAAGGTTCTCAAGAATCCTACTTTCATGCCGGAGAGCGAGGGTACCATAAGTTGTGGGATAGCAGGCTGTTCAACTATGCCAATTGGGAGGTTCTTCGTTTCCTTCTTTCCAACTTGAGGTGGTGGCTAGAAGAGTATAACTTTGACGGATTTCGATTTGATGGAATAACTTCTATGTTGTATGTTCATCATGGAATCAATATGGGGTTTACAGGAAACTATAATGAGTATTTCAGCGAGGCTACAGATGTTGATGCTGTCGTCTATTTAATGTTGGCCAATAATCTGATTCACAAGATTTTCCCAGACGCAACTGTTATTGCCGAAGATGTTTCTGGTATGCCGGGCCTTGGCCGGCATGTTTCTGAGGGAGGAATTGGTTTTGATTATCGCCTGGCGATGGCAATCCCAGATAAGTGGATAGATTATGTAAAGAACAAGAATGATGAAGATTGGTCCATGAAGGAAGTAACATCGAGTTTGACAAATAGGAGATATACAGAGAAGTGTATAGCATATGCTGAGAGCCATGATCAGTCTATTGTCGGTGACAAGACCATTGCATTTCTCCTAATGGACAAAGAGATGTATTCTGGCATGTCTTGCTTGACAGATGCTTCTCCTGTTGTTGATCGAGGAATTGCGCTTCACAAGATGATCCACTTTTTCACAATGGCCTTGGGAGGAGAGGGGTACCTCAATTTCATGGGTAACGAGTTTGGCCATCCTGAGTGGATTGACTTCCCTAGAGAGGGCAATAATTGGAGTTATGACAAATGTAGACGCCAGTGGAACCTCGCGGATAGTCAACACTTGAGATACAAGTTCATGAACGCATTTGATAGAGCTATGAATTCACTCGACGAGAAGTTCTCATTCCTTGCATCAGGAAAACAGATAGTAAGCAGCATCGATGATGATAATAAGGTTGTTGTGTTTGAACGTGGTGACCTGGTATTTGTATTCAACTTCCACCCAAATAACACATACGAAGGGTATAAAGTTGGATGTGACTTGCCAGGGAAGTACAGAGTTGCACTGGACAGTGATGCTTGGGAATTTGGTGGCCATGGAAGAGTTGGTCATGATGTTGACCATTTCACATCACCAGAAGGAATACCTGGAGTTCCAGAAACAAATTTCAATGGTCGTCCAAATTCCTTCAAATTGCTGTCTCCTGCGCACACATGTGTGGCTTATTACAGAGTTGACGAATGCATGTCAGAAACTGAAGTTTACCAGACAGACATTTCTAATGAGCTACTACCAACAGCCAATATCGAGGAGAGTGACGAGAAACTTAAAGATTCATTATCTACAAATATCAGTAACATCGGTCAGACTGTTGTAGCTTCTGTTGAGGAGAGAGACAAGGAACTTAAAGATTCACCTATCTGTAAGCATCATTAGTGATGTTGTTCAAGCTGACTGAGGTGATTCGGATGCAAACGTCTGGATCAGATGTCTTCTACGTTGGTGATCTTAGTCCGCGCATGTTGCCTTCAGGGTGGTAGCATTTCCTCTGCAAATTATTAGCATCCAATAAATTTACTGGTTGTAAATAGAAAAAATGCATTTGCATGTATCTTCCTCTGAAATTTTCCCAGTTTTTGGTGCTTTGCCTTTGAAGCCAAGTCTCTATATGTAATAAGAAGACTAAGAACAATCACATATATAAAATGTTACTAGTAGATTAAAAAAAAAAAAAAAAAAAAAAAAAAATCAATAAAGACGTGGGGGGGACCGCCTCCCAATGACCCCTATATGGGAACGCATTGATGATCCCTCGCCGGTCATTTAAAAAACACAGCGTGATCTACGTGCAAAGAGGAGATGCACAAGTGCAAGTAGTAGACCACACCGGGCAACAAGTGATGAATGACAGGGTAAATCAAGGAGAAATGTTTGTAGTCCCTCAGTACTATGCCTCAACAGTGAAAGCAGGGCAAAATGGATTTGAATTCGCGGTGTTTAGGACAAGCAGTCAACCAATGAACAGCCAACTTGCAGGTTACACATCAGTGATTAGAGCAATGCCAATTGAGGTCCTCACAAACGCGTACCAGATATCGCCAAATGAAGCACAACGTTTGAAAATGAACAGAGGAGGAGAAAGCTTCCTGCTATCTCCCCAGAGAAGGTCATTCTAAAATGGCTTTAATGTGTAATAATCCCACCTTGGCTATCGCCTAGTAGTACAAGTTTCTAGTCTTTGTTTTTAGGCAAAGATGAAGCAAGAGCGACTTGTATTTAGGAGCAAATAATGTAACGAATAAAGCTCCTGCCTTTTTGTACCT

 

3459

 

43088

 

Contig1940

LC04BD10/FA28AA08/LC01DA05/LEFL2047P06/LEFL2026B20/FC10DA07/sgn|E245050/sgn|E201941/sgn|E374816/FA15DF01/LC15DE02/LC11BG05/LEFL2023L19/LEFL2040M10/sgn|E213902/sgn|E211872/sgn|E327762/FA10CB12/sgn|E265172/sgn|E266640/sgn|E276516/sgn|E246886/sgn|E242791/sgn|E244847/sgn|E209286/sgn|E273302/sgn|E241038/FA04CA01/sgn|E211821/sgn|E206420/sgn|E211598/sgn|E272497/sgn|E368481/sgn|E240105/sgn|E272539/sgn|E272803/sgn|E209507/sgn|E201663/sgn|E550663/sgn|E306081/sgn|E212318/sgn|E556998/sgn|E552570/sgn|E557056/sgn|E555000/LC06BD05

3445

TC174428 similar to UP|Q8VZF2_ARATH (Q8VZF2) AT4g23460/F16G20_160, partial (63%)

2303

Show
Contig1940

Contig1940

 

LC04BD10/FA28AA08/LC01DA05/LEFL2047P06/LEFL2026B20/FC10DA07/sgn|E245050/sgn|E201941/sgn|E374816/FA15DF01/LC15DE02/LC11BG05/LEFL2023L19/LEFL2040M10/sgn|E213902/sgn|E211872/sgn|E327762/FA10CB12/sgn|E265172/sgn|E266640/sgn|E276516/sgn|E246886/sgn|E242791/sgn|E244847/sgn|E209286/sgn|E273302/sgn|E241038/FA04CA01/sgn|E211821/sgn|E206420/sgn|E211598/sgn|E272497/sgn|E368481/sgn|E240105/sgn|E272539/sgn|E272803/sgn|E209507/sgn|E201663/sgn|E550663/sgn|E306081/sgn|E212318/sgn|E556998/sgn|E552570/sgn|E557056/sgn|E555000/LC06BD05

 

3445

 

TC174428 similar to UP|Q8VZF2_ARATH (Q8VZF2) AT4g23460/F16G20_160, partial (63%)

 

2303

 

4084

 

0

 

2060

 

100

 

3445

 

AK068938|Os03g0355600 Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain). Splice isoform B.

 

893

 

1391

 

0

 

896

 

80

 

3445

 

gb|AAF61672.1| beta-adaptin-like protein B [Arabidopsis thaliana]

 

894

 

1405

 

0

 

897

 

81

 

3445

 

SGN-U315162

 

3195

 

5852

 

0

 

2952

 

100

 

3445

 

O35643|AP1B1_MOUSE AP-1 complex subunit beta-1 (Adapter-related protein complex 1 beta-1 subunit) (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain) - Mus musculus (Mouse)

 

943

 

836

 

0

 

611

 

70

 

3445

 

AT4G11380.1 | Symbol: None | beta-adaptin, putative, strong similarity to SP:Q10567 Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Homo sapiens), beta-adaptin (Drosophila melanogaster) GI:434902: contains Pfam profile: PF01602 Adaptin N terminal region | chr4:6920503-6925964 FORWARD | Aliases: F8L21.170, F8L21_170

 

894

 

1404

 

0

 

897

 

81

 

ATCGGCCGAATTCCCATGGGGATCCGATCTCTTTCTCTGCTGTGTTCTCTCCACCGGCAGCTTCACCGACTGTCCGATTCCGATCAAAGAAATGAGCGGTCACGATTCAAAGTACTTCTCTACTACGAAGAAGGGAGAAATCCCTGAGCTCAAAGAAGAACTCAATTCTCAGTACAAGGACAAGAGAAAAGATGCTGTCAAAAAGGTCATTGCTGCTATGACCGTTGGGAAAGATGTTTCTTCACTGTTCACAGATGTTGTTAATTGCATGCAAACAGAGAATTTGGAGTTGAAGAAGCTTGTATACTTGTATCTAATCAATTATGCTAAAAGCCAGCCTGATCTTGCTATTCTTGCCGTAAATACGTTTGTGAAGGATTCGCAAGACCCAAATCCTTTAATTCGTGCTTTGGCTGTACGGACTATGGGATGCATTCGTGTTGACAAGATCACCGAGTATTTATGTGATCCCCTCCAACGTTGCCTAAAGGATGATGATCCTTATGTTCGTAAGACAGCAGCTATCTGTGTTGCTAAGCTCTATGACATAAATGCCGAACTTGTGGAAGATAGGGGCTTTTTGGATGCTCTCAAGGACTTAATATCTGACAATAATCCGATGGTTGTTGCAAATGCTGTTGCGGCTCTTGCAGAAATTCAAGAAAGCAGTAGCAGGCCCATCTTTGAGATCACCAGCCATACACTTTCAAAGCTTCTAACTGCTCTGAATGAATGCACTGAGTGGGGTCAAGTGTTTATACTGGATGCTCTGTCAAAGTACAAAGCAGCTGATGCTCGTGAAGCTGAAAACATAGTGGAGCGAGTCACTCCACGATTACAGCATGCAAATTGTGCTGTTGTTCTTTCAGCTGTAAAGATGATACTCCAACAGATGGAACTCATCACCAGCACTGATGTAGTTCGAAACCTTTGTAAAAAGATGGCTCCTCCTCTTGTAACGTTGCTTTCAGCAGAGCCTGAAATTCAGTATGTTGCGTTAAGGAACATAAACCTCATTGTACAAAAGCGTCCGACAATTCTTGCACATGAAATCAAGGTATTCTTTTGCAAGTATAATGATCCTATATATGTGAAAATGGAGAAGTTAGAAATTATGATAAAACTTGCTTCAGACAGAAACATAGACCAGGTGCTATTGGAGTTCAAAGAATATGCTACTGAAGTAGACGTTGACTTTGTCAGAAAAGCTGTCCGTGCTATTGGCCGCTGTGCCATCAAATTAGAGAGGGCAGCGGAACGCTGTATCAGTGTCCTGCTTGAATTGATCAAGATAAAAGTAAACTATGTTGTTCAAGAAGCTATTATAGTAATTAAGGACATTTTCAGAAGATATCCTAACACCTATGAGTCCATAATTGCTACTCTTTGCGAGAGTTTGGACACGCTAGATGAGCCAGAGGCAAAGGCATCAATGATCTGGATTATCGGTGAGTATGCTGAAAGAATTGATAATGCAGATGAGCTCCTTGAAAGCTTTTTGGAGAGTTTCCCTGAGGAACCTCCCCAAGTGCAATTGCAGTTGCTGACAGCAACAGTCAAACTCTTCCTCAAGAAGCCAACTGAAGGACCACAACAAATGATCCAGGTGGTTTTAAATAATGCCACTGTGGAGACTGACAATCCAGACTTGCGAGATCGTGCATACATTTATTGGCGTCTTCTCTCAACTGATCCTGAGGCAGCTAAAGATGTTGTGCTAGCTGAAAAGCCCGTGATTAGTGATGATTCAAACCAACTTGATCCTTCTCTCCTTGATGAACTTCTTTCCAACATTGCTACTTTATCCTCTGTCTATCATAAGCCTCCAGAAGCATTTGTCACTCGTGTGAAGACCACTCAGAAAACTGAAGAGGAAGATTATCCGGAGGCAGGTGAACAGAGCTATTCCGATTCTCCTGCTCGTGTTGCAGATAGTGGTGCGTCACCGCCAGCTAGTTCAGCTAATCCTCAGCATCCTGCATCAAGGCAACCAGCTGCACCTGCAGCGCTGCCTGATTTACTTGACCTTGGCATGGATAACAGCGGTAGTGCTATTGTGTCAGTTGATCAGCCTGCAAGCCCAGCTGGCCCTCCGTTACCTGTCGTATTGCCAGCATCTAGTGGTCAAGGTTTACAAATCAGTGCCCAACTGATACGGAGAGACGGGCAGGTATTTTACAGCATGATGTTTGAGAACAATTCACAGGTTCCTCTTGATGGCTTCATGATTCAGTTTAATAAAAACACATTTGGTCTTGCTGCCGGTGGACAACTCCAAGTTCCTCAATTGCTACCTGGGACATCTGCAAGCACTCTCTTGCCGATGGTTTTGTTCCAGAACATTTCCCCTGGCCCTGCAAATACCCTTTTACAGGTTGCGATTAAAAATAACCAACAGCCAGTATGGTATTTCAATGATAAAATCTATTTCCATGTACTTTTTACGGAGGATGGGAGGATGGAGCGCTCCACTTTTCTTGAGACTTGGAAATCACTTCCTGATTCAAATGAGGTATCAAGGGACTTCCCAGCATCTGTTATCAATAGCGTTGAAACAACCCTTGATCGTCTAGCTGCATCAAACATGTTCTTTATAGCTAAGCGCAAACATGCTAACCAAGAGGTGTTGTATCTTTCTGCCAAGATCCCCCGAGGAATCCCTTTCTTGATCGAACTTACAGCAGTTATCGGAACCCCTGGTGTCAAATGTGCCATCAAAACTCCAAGCCCTGAAATGGCTCCTCTCTTCTTTGAAGCCGTCGAGACTTTGCTCAAGAGTTGATAAGTTTGCTACTTATCCCATCTCCCTTTATTTATATCCCCTGTAATTTTGTTTTTGGTACACGTCTTATATTTTTGCTCTTATTAATTAGCTTGAGTTTCCAGGTTTGAACTGTTAATTCATGCTTCATCCTATGTTCAGAGCTTGTTATTATAGTTTTTTTTTTTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCCGGGGGGGGGGCCGGGCCCCCATTCCCCCCTAGGGGGGGCCTTAAAAAACANAAAAGGCTAATCATCTGTGACTTCCACCAAAATTTCATCTTTTGGTGTCCGCTTCAAATCATTCTGCTTTCCGTGGATAAGAATCTCTGAGGCTATTGAATTTATGCTCTGGGAATGCATATGGCTGCATATACAGATTTTTCACCACCATTTGCTATAGTAGAAGGGAGTTACAGTAAGGAGAATACATCTGCTGTTAAAGATGAATTACTTGAGGAATCAAATGAAATAAAGACAACAAGTGATAAGCCACTACGAGATCCTTCTGTTGTACAGTATTCAGTGAACTCTACTGCACTTGTAGGAGACGCTGATTTAGATTTTGAAATAACTGAGAAGGGTTTCCAACACCCTTCTGAGGGACAATCAAACTTTGAACCAATATTTCGTTCTGGAAGTTGT

 

3445

 

24624

 

Contig1439

LEFL1049DC06/LC14AC01/LEFL1065CA04/LC11CH02/FA21CG07/LEFL1070DF11/LC14BE10/LEFL1066CE10/LEFL1063BD01/LC21DB06/FA17DA11/LC19AF02/sgn|E344488/LC20BH03/LA23DE04/sgn|E250087/sgn|E283195/FA11BB12/sgn|E249304/sgn|E325919/sgn|E259098/FA56CD07/sgn|E300015/sgn|E253204/sgn|E311038/FB19BE09/sgn|E342324/FB06DH09/LC04DC02/FB17AC12

3407

TC176242 similar to UP|Q9LKZ5_SOYBN (Q9LKZ5) Receptor-like protein kinase 2, partial (59%)

2093

Show
Contig1439

Contig1439

 

LEFL1049DC06/LC14AC01/LEFL1065CA04/LC11CH02/FA21CG07/LEFL1070DF11/LC14BE10/LEFL1066CE10/LEFL1063BD01/LC21DB06/FA17DA11/LC19AF02/sgn|E344488/LC20BH03/LA23DE04/sgn|E250087/sgn|E283195/FA11BB12/sgn|E249304/sgn|E325919/sgn|E259098/FA56CD07/sgn|E300015/sgn|E253204/sgn|E311038/FB19BE09/sgn|E342324/FB06DH09/LC04DC02/FB17AC12

 

3407

 

TC176242 similar to UP|Q9LKZ5_SOYBN (Q9LKZ5) Receptor-like protein kinase 2, partial (59%)

 

2093

 

4060

 

0

 

2077

 

99

 

3407

 

Os07g0134200|Os07g0134200 Receptor-like protein kinase 3.

 

1023

 

1373

 

0

 

1005

 

68

 

3407

 

gb|AAF91323.1|AF244889_1 receptor-like protein kinase 2 [Glycine max]

 

1012

 

1548

 

0

 

993

 

76

 

3407

 

SGN-U316643

 

2203

 

3848

 

0

 

1962

 

99

 

3407

 

Q9SYQ8|CLV1_ARATH Receptor protein kinase CLAVATA1 precursor (EC 2.7.11.1) - Arabidopsis thaliana (Mouse-ear cress)

 

980

 

983

 

0

 

953

 

53

 

3407

 

AT5G65700.1 | Symbol: None | leucine-rich repeat transmembrane protein kinase, putative | chr5:26298986-26302473 FORWARD | Aliases: MPA24.5, MPA24_5

 

1003

 

1521

 

0

 

992

 

75

 

ATATACACACCAAACGGATTACCCACCCTCAAACCAAATCCTCATTTTTGCCTTTCTCACTCTAACTGAGTGAAACTGCAAACCAAACAGTAGGTGGGCGTTAGATTAACGAAGCAAAAATGCGTCTTCTTTTTTTTCTTCTTCTTCTTATGCATTTTACTGACTTTTCTGCCGGTAAACAACCACGCTTACCGGAATACCAGGCTTTGCTTGCCCTGAAAACTGCCATTACCGATGACCCGCAGTTAACTCTTGCCTCATGGAACATCTCCACCAGTCACTGTACGTGGAATGGTGTCACGTGCGACACGCATCGTCACGTGACCTCTCTTGATATTTCTGGGTTTAATCTTACCGGTACTCTTCCGCCGGAAGTTGGAAATCTTCGTTTCTTACAAAATTTGTCTGTTGCTGTTAACCAGTTTACTGGACCTGTACCTGTTGAAATCTCCTTTATTCCAAATCTGAGTTACCTTAATCTTTCTAATAACATATTCGGGATGGAATTCCCTTCGCAGTTAACACGTCTGCGTAACCTCCAAGTCCTTGACCTTTACAACAACAATATGACCGGTGAACTTCCCGTTGAGGTGTATCAGATGACTAAACTTCGACATCTACACCTAGGCGGGAACTTTTTCAGTGGCCGCATTCCTCCGGAGTATGGAAGATTCCCGTCTCTAGAGTACCTTGCAGTTTCAGGCAATGCATTGGTAGGAGAGATACCACCGGAGATTGGAAACATCGCTACACTTCAGCAGTTGTATGTAGGATACTACAATACCTTCACCGGTGGGATTCCACCGGCAATAGGGAACTTATCGCAGCTCCTTCGGTTTGATGCTGCTAACTGTGGACTTTCGGGGAAGATTCCACCGGAGATTGGGAAGCTTCAGAACCTTGATACCCTCTTCCTGCAAGTGAATTCTCTATCTGGATCTTTAACTCCGGAGATAGGTTATCTGAAGAGCTTGAAATCTTTGGATCTGTCGAATAACATGTTCTCTGGCGAGATACCGCCGACATTTGCGGAGCTTAAGAATATCACTCTTGTTAATCTTTTCCGGAATAAGCTTTATGGGTCAATACCAGAGTTCATAGAGGACTTGCCGGAACTAGAGGTGTTGCAACTTTGGGAAAATAACTTTACTGGAAGCATTCCTCAGGGGTTAGGCACAAAGAGCAAGCTCAAAACTCTTGATCTCAGTTCCAATAAATTAACGGGAAATTTACCCCCAAACATGTGCTCCGGTAACAATCTGCAGACAATTATCACTCTAGGGAACTTCTTGTTTGGCCCAATTCCTGAATCTTTGGGTAGGTGTGAATCACTTAATCGTATTAGAATGGGAGAAAATTATCTGAATGGGTCTATTCCAAAAGGGCTCTTAAGCTTGCCACATCTGTCACAAGTTGAACTTCAGAATAATATTCTCACTGGTACATTTCCTGATATTTCTTCCAAATCTAACAGTCTTGGCCAGATTATCCTTTCAAATAATCGCTTAACTGGACCTTTGCCACCAAGCATTGGAAACTTTGCTGTAGCCCAAAAATTGCTTCTTGATGGGAACAAATTTTCGGGACGAATTCCAGCTGAAATAGGAAAGCTTCAACAGCTATCCAAAATTGATTTCAGTCATAACAACTTGTCTGGACCCATTGCTCCGGAGATTAGCCAGTGCAAGTTGCTGACTTATGTTGATCTCAGCAGGAACCAACTTTCGGGTGAGATTCCTACTGAGATCACAGGTATGAGAATACTCAACTACTTGAATTTATCGCGAAACCACTTAGTTGGGAGTATTCCTGCCCCTATTTCTAGTATGCAGAGTTTAACTTCTGTTGATTTCTCGTATAACAACTTTTCTGGTTTAGTTCCTGGAACCGGGCAATTTAGTTATTTCAATTACACCTCATTTCTAGGCAATCCAGATCTTTGCGGACCCTATTTGGGCCCTTGCAAAGAGGGCGTTGTTGATGGGGTTAGTCAACCTCACCAACGAGGAGCCTTAACGCCTTCGATGAAGCTTTTACTTGTTATAGGTTTGCTTGTCTGTTCTATTGTGTTTGCTGTTGCTGCAATTATAAAGGCCCGATCTTTAAAGAAGGCAAGTGAAGCTCGTGCCTGGAAGCTAACTGCTTTTCAGCGCCTGGATTTTACTTGTGATGATATTTTGGATAGCTTGAAGGAGGATAACGTTATTGGAAAAGGAGGTGCTGGTATTGTCTACAAGGGGGTAATGCCTAGCGGGGAACATGTAGCGGTTAAGAGGTTGCCAGCTATGAGCAGGGGTTCCTCTCATGATCATGGGTTCAATGCAGAGATACAGACTCTTGGGAGGATCCGACACAGGCACATTGTTAGATTATTAGGGTTTTGCTCGAATCATGAGACAAATCTTTTGGTTTACGAGTACATGCCTAATGGAAGTCTTGGGGAAATGCTTCATGGCAAGAAAGGCGGTCATTTACATTGGGATACCAGGTATAAGATTGCCTTGGAGTCTGCTAAGGGTCTTTGCTATCTCCATCACGATTGCTCTCCTTTGATCCTCCATCGTGATGTGAAATCAAACAACATTCTGCTGGACTCCAGCTTTGAAGCTCATGTTGCTGATTTTGGACTTGCTAAGTTCTTGCAAGATTCAGGGACATCAGAATGCATGTCTGCTATTGCTGGTTCTTATGGGTACATTGCTCCAGAATATGCTTACACACTTAAGGTTGATGAGAAGAGTGATGTATATAGCTTCGGTGTGGTGCTACTAGAACTGGTAAGTGGCAAAAAACCAGTTGGAGAATTTGGTGATGGTGTTGACATAGTCCAATGGGTTAGGAAAATGACTGATGGGAAAAAGGATGGAGTTCTCAAGATCCTTGACCCAAGACTCTCAACGGTTCCCCTTAATGAGGTGATGCATGTCTTCTATGTCGCATTGTTGTGTGTCGAAGAGCAGGCTGTGGAACGTCCCACCATGCGAGAGGTAGTGCAAATACTAACGGAACTTCCCAAGCCACCAGGTGCAAAATCAGATGACTCAACCGTCACTGATCAGTCGCCCCCATCAGCCTCTGCATTAGAGTCCCCAACCTCAATTCCCGGGGACACAAAAGACCATCATCAACCAACACCTCAATCACCTCCACCTGACCTACTCAGTATCTAATTTGCAATGTTCTTGAAGTAGGAGTGTTTTATTTAGTTTGATTCTCTAGTTCTATTATGATCAATTGTGCTAAGCTTTATTCCTTTGTTTTAAAAAAATTGGGTCTTTCTAGGCTCGGGGGTTTATTCTAACTCTAAGATGGGTTTAATGCTCAGAAGTTTTCCTCTTGTACAGTAAGATTGGTAGGGTTTTCAAGTGTATTATTAAATGGAAAAAAATTGCCCTTCAAAAAAAAAA

 

3407

 

24123

 

Contig11094

sgn|E246289/sgn|E369112/FA21CH10/FA16CH03/sgn|E263582/LEFL2011J01/sgn|E293047/sgn|E264225/sgn|E244238/sgn|E248090/sgn|E261101/sgn|E252657/sgn|E556203/sgn|E333991/sgn|E279726/FA25CH10/FA33DC10/FA11BE10/FA14DC03/sgn|E394967/sgn|E249579/sgn|E369111/sgn|E249945/sgn|E244298/sgn|E218230/sgn|E218013/sgn|E218089/sgn|E217874

3344

TC176747 similar to UP|Q9LUM0_ARATH (Q9LUM0) Emb|CAB36798.1, partial (33%)

3325

Show
Contig11094

Contig11094

 

sgn|E246289/sgn|E369112/FA21CH10/FA16CH03/sgn|E263582/LEFL2011J01/sgn|E293047/sgn|E264225/sgn|E244238/sgn|E248090/sgn|E261101/sgn|E252657/sgn|E556203/sgn|E333991/sgn|E279726/FA25CH10/FA33DC10/FA11BE10/FA14DC03/sgn|E394967/sgn|E249579/sgn|E369111/sgn|E249945/sgn|E244298/sgn|E218230/sgn|E218013/sgn|E218089/sgn|E217874

 

3344

 

TC176747 similar to UP|Q9LUM0_ARATH (Q9LUM0) Emb|CAB36798.1, partial (33%)

 

3325

 

6589

 

0

 

3324

 

100

 

3344

 

Os03g0399500|Os03g0399500 Chaperonin Cpn60/TCP-1 family protein.

 

1837

 

947

 

0

 

967

 

52

 

3344

 

gb|ABE86459.1| Chaperonin Cpn60/TCP-1: Phosphatidylinositol-4-phosphate 5-kinase: Zinc finger, FYVE/PHD-type [Medicago truncatula]

 

1819

 

1058

 

0

 

961

 

58

 

3344

 

SGN-U316504

 

3344

 

6589

 

0

 

3324

 

100

 

3344

 

P34756|FAB1_YEAST 1-phosphatidylinositol-3-phosphate 5-kinase FAB1 (EC 2.7.1.150) (Phosphatidylinositol-3-phosphate 5-kinase) (Type III PIP kinase) - Saccharomyces cerevisiae (Baker's yeast)

 

2278

 

285

 

6.00E-76

 

424

 

37

 

3344

 

AT3G14270.1 | Symbol: None | phosphatidylinositol-4-phosphate 5-kinase family protein, similar to SP:Q9Z1T6 FYVE finger-containing phosphoinositide kinase (EC 2.7.1.68) (1- phosphatidylinositol-4-phosphate kinase) (PIP5K) (PtdIns(4)P-5-kinase) {Mus musculus}: contains Pfam profiles PF01504: Phosphatidylinositol-4-phosphate 5-Kinase, PF01363: FYVE zinc finger, PF00118: TCP-1/cpn60 chaperonin family | chr3:4753932-4761460 FORWARD | Aliases: MLN21.6

 

1791

 

987

 

0

 

966

 

55

 

TAGGGTCACTACAGCAAGATTATCCTTCCTCACCTTCCGACCAACTGATTATTGTAGTATGCCTTTCAACACGCTGTGTTTGGAAAGGAACTGTTTGTGAGCCACCTCATATTTCTCGAATAAAATTTTATGGGATTACCGATATGCCTTTGGGACGGTTTTTACGAGACCGGTTGTTTGATGAGAATTTTAGGTGTCCCTCATGTGAAATGCCTCCAGAAGCACATGTTCGTTGCTATACTCATCGGCAAGGCAGCCTCACAATTTCTGTAAAGAAGCTACCTGAATGTATCTTGCCAGGAGAACAGGAAGGAAAGATATGGATGTGGCACAGATGTCTGCGATGTCCTCGGGACAATGGTTTCCCTCCTCCAACCAGGAGGGTAGTAATGTCTAATGCTGCTTGGGGGTTGTCATTTGGGAAATTTTTGGAACTCAGTTTTTCAAATCATGCAGCAGCGAGCAGGGTTGCAAGTTGTGGTCATCTTCTTCACCGGGACTGTCTCCGGTTCTATGGGTTTGGGAAAATGGTAGCTTGTTTTCGATATGCTCCTGTTCATGTTTATTCTGTCTTTCTCCCACCTCCAAAACTCGAATTTAGCTATGATAATCAGGAGTGGATTCAGAAAGAAGGTGATGAGGTGCGCAGAAGGGCTAATGCGTTGTTTGCTGAGGTGTCCAAAGTTCTTCATGTCAAGTTGGAAAAATTCTCTGTTGATAGCAGCTTGAAAGCACCCAAGACAAGTGAGCAGATCACAGAGATGGAAGAAATATTAGAGAAGGAGAAAACTGAGTTTGAGGGATTATTACGCAAGGCACTTAGCAGGGAGATCAAAGTTGGTCAGCCTACAGTTGACATCCTTGAGATAAATCAACTGAGAAGGCAGTTGGTTTTTCATGCTTATCTATGGGACAGACGTTTGATACATCTTTCCAGTTCTCATGGTAAAAATTCCCGAACTCCGGGCAGTTTGACACAACTGAAGGAGAAACCCCTCAGCTCTAGTGAGGAACTTCCTGAAAGGACTGCAATTTTGAGACCTGGAAAAAGTTTGGGGAGCTATGATTCAGCTCTTCAGAATGTGAAGACTGAAATAACATCTAGTGAAGGAAGACATGGTCAGATTCCTGATGGGGTTCACGAAAGATTGACTACTGATGAGAACCTAACTCACGGGAAAGACTGCGAGATTTTCTGTGCTATAAGAAATACAGGAGATGGTAATGTACTGGAACCTGGAAAAAATGTCAGACGTGTTCTTTCAGATGCAAAGTTCCCGTCTGTGGGAAGTTTATCCGACACTCTTGATGCTGCATGGACCGGTGAAAGCCACCTGGCTATTAAAGAGCATAACAGTGCATTTCCAGGTTCGTTCGTTGTAGATTCTACTGCTTTGACTGGAGTTTCAGCAAATACAGATGTCGAAAGGTCTCTGTGTGACAAAAATGGGGCTGAAATACCTCATTTATCTGCTAAGTCTGACAACACAGATTACCTGACCTGGGCAACGGCACATTTCTCAAATTTCTATCGTTCGTTCAACAAGAATATCACAGCAAATCCACAATATGTTGCTAAATTGAATGAGCATAATCCTGTTTATATCTTGTCGTTTAGCGAATTGCTACATCAAGGTGGTGCCAGGCTTCTTACAGCTGTTGGTGAAAATGACATTGTTATTCCAGTTTATGATGATGAGCCGACAAGTATCATCTCATATGCACTTGTCTCACCAGATTACCGCAATCAAATGTCAGATGAATCTCAAAACCTGAAAGAAAATCACAAGTTTTCAGCTTCTTTGTCATTTCTGGATTCATTAAATCTACTTCCGCTTCACTCTGTGGATGGAGTAGTTTCGGAATCTCCAAGAAGTTTTGGATCTACCAACGAAAGCATGTCATCGGGTTATAGTTCTCGCAGCTCAAACATGGATCCACCAGCATATATTAATGCTTTGCATGCCCGAATATCTTTCTCAGATGATGGCCCTCCTGGAAAGGTTAAGTACACAGTCACCTGCTATTATGCGAAGCAATTCGAGACCTTGAGAAAGTCTTGTTGCCCCAATGAATCAGACTTTATACGTTCCCTTAGCCGATGCAAAAAATGGGGTGCTCAGGGTGGGAAGAGCAATGTTTTCTTTGCCAAAACCTTGGACGACCGATTTATCATCAAGCAGGTAACGAAGACAGAGTTGGAGTCATTTATCAAGTTTGCACCAGCTTACTTTAAGTATTTATCTGACTCAATAGCTAGTGGGAGCCCAACTTGCTTGGCAAAGATTCTGGGGATCTACCAGGTTACATCAAAGCATCTCAAAGGTGGGAAAGAATCAAGAATGGATGTGCTTGTTATGGAAAATCTTCTTTTTAAGCGCAACATCACTAGACTGTATGACCTCAAAGGGTCGTCTCGATCACGCTATAATCCAGATTCAAGTGGAAGTAACAAAGTTTTACTTGATCAGAACTTGATTGAAGCAATGCCAACTTCTCCGATTTTTGTGGGAACGCAAGCTAAGCGGCTGCTGCAGAGAGCTGTGTGGAATGATACTTCATTTCTAGCGTCAATAGATGTGATGGATTACTCATTACTAGTTGGGGTGGATGAGAAGAAGCAGGAACTGGTGCTTGGTATTATTGATTTCATGAGACAGTATACGTGGGACAAGCATCTCGAGACTTGGGTAAAGGCTTCAGGTATTCTAGGTGGGCCGAAGAATGCAGCCCCAACGGTGATTTCTCCAAAGCAATACAAAATAAGATTCAGGAAAGCAATGTCTACATACTTTCTGATGGTGCCAGATGAGTGGCCTACATGAAGTGATACCCCAAGTATCAGTGCAGAAAAATTGCCCCGGCCGGTCTTGGTATAATTTTATCCATCCTTTCTTATGCCATCAAGTTTTGTGTATTTTGTGCAGGAATGTTGGGTAGTTGCTTTATCATTAGAGGATTACTTTTGTTTTTCCAAAGTAGTAGTATTACAGAGTTATTTCCATACAAAGAATTTGTTAGTTTCTGGGCGTTCCGCCAGTTGTACAGTCAATAGTCGGTCTTCGTTTCTTTTTATCCCACATTCTGATGCTCAATGGAAGCTCTTGGTATATTCATGTGTTTACATGAGAATTGAGACTCTTTTGACAAGGGCTGCCGTGGTAGCAGTAAAGATCAATGTAATTTGATCTTGTAAGTCCTACAATCGGATGGTTTCAAATAAGCTGCACTCGCGACATTTTGATTTTCAGGCACCTATGCAATGAGTTGTACTTGTCGCGATTCTTCGCCTCCTTCCTATTTTGCACACGGTATAGGTTGATCAAAAAAAAAAAAAAAAAAAA

 

3344

 

33778

 

Contig15272

LEFL1040CA09/sgn|E209577/FC09DG08/sgn|E327256/LEFL1034DD05/sgn|E310286/LC15AG05/LC17CC11/LEFL1036DH01/LEFL2048P05/LEFL2037I11/LEFL2018P01/LC07AD08/LEFL2010D21/sgn|E328316/LC04DF10/sgn|E214701/LC12AH09/sgn|E281154/sgn|E339703/sgn|E330794/LC22AE12/sgn|E325596/sgn|E267528/sgn|E370054/sgn|E259577/sgn|E259576/sgn|E252665/sgn|E260884/LEFL1093DG10/sgn|E275392/sgn|E282933/sgn|E274059/sgn|E275283/sgn|E276080/FA32DC03/FA52AH06/FA53DD10/FA12AA06/FA26CE11/LEFL2003BD07/LEFL2042A12/sgn|E226810/sgn|E226673/FB18BA09/sgn|E370053

3329

TC170930 UP|Q2LAJ3_LYCES (Q2LAJ3) Auxin response factor 2, complete

2719

Show
Contig15272

Contig15272

 

LEFL1040CA09/sgn|E209577/FC09DG08/sgn|E327256/LEFL1034DD05/sgn|E310286/LC15AG05/LC17CC11/LEFL1036DH01/LEFL2048P05/LEFL2037I11/LEFL2018P01/LC07AD08/LEFL2010D21/sgn|E328316/LC04DF10/sgn|E214701/LC12AH09/sgn|E281154/sgn|E339703/sgn|E330794/LC22AE12/sgn|E325596/sgn|E267528/sgn|E370054/sgn|E259577/sgn|E259576/sgn|E252665/sgn|E260884/LEFL1093DG10/sgn|E275392/sgn|E282933/sgn|E274059/sgn|E275283/sgn|E276080/FA32DC03/FA52AH06/FA53DD10/FA12AA06/FA26CE11/LEFL2003BD07/LEFL2042A12/sgn|E226810/sgn|E226673/FB18BA09/sgn|E370053

 

3329

 

TC170930 UP|Q2LAJ3_LYCES (Q2LAJ3) Auxin response factor 2, complete

 

2719

 

5128

 

0

 

2591

 

99

 

3329

 

AF140228|Os11g0523800 Transcriptional factor B3 family protein.

 

852

 

832

 

0

 

852

 

54

 

3329

 

gb|ABC69711.1| auxin response factor 2 [Lycopersicon esculentum]

 

846

 

1669

 

0

 

846

 

97

 

3329

 

SGN-U314233

 

3338

 

6466

 

0

 

3295

 

99

 

3329

 

Q94JM3|ARFB_ARATH Auxin response factor 2 (ARF1-binding protein) (ARF1-BP) - Arabidopsis thaliana (Mouse-ear cress)

 

859

 

1011

 

0

 

876

 

60

 

3329

 

AT5G62000.3 | Symbol: None | transcriptional factor B3 family protein / auxin-responsive factor, putative (ARF1), contains Pfam profile: PF02362 B3 DNA binding domain: identical to cDNA ARF1 (auxin response factor) binding protein GI:2245393 | chr5:24927608-24932431 FORWARD | Aliases: None

 

859

 

1011

 

0

 

876

 

60

 

TTTTGTGTCCTTTTCTTTTTTTTTGCTCTCTTTCTCTCTCATCACTCACATGAAGAAGCTCCTACTTCTATCCATTGAAGATAGATAAATGAACACGCATATACAAACAGTTTTTAGAGAGAGAAACTAGAGCGAGAAGGCTCTGTAACTTCAATTTTGAGTGTTGATTGCTGTTTCTAGGGTCTCTTTGGTTACCAGTTTTGCATGCTTTTGAGCTGAGGAAGAGTTTAGTGCTTTTTTTCTGGTGAATTTTGGAGAAGGAAGTTTTATTTTGTGCTTGTTTTATGAATTGATTAGTGTGGATATGAGAGATCTGTGTTGAGAATTAGTGTACGGAAATGGCTGCTTCGGAGGTGTCGATTCAAGGTTACAGCGAGCCGAGTGATGGTTCTAGGCCGGTTTCAGAGACTGGTAGGAGTAGTTCCGGTGTCGGAATAGTTGATGCTGATACGGCGTTGTACACGGAGCTTTGGCGTTCATGTGCCGGTCCACTTGTGACGGTACCGCGAGAGGGTGAGCTGGTGTACTATTTCCCTCAAGGACATATCGAGCAGGTTGAAGCATCAACTAATCAAGTGGCTGACCAGCAGATGCCTTTGTATAATCTTCCATCTAAGATTCTATGCCGTGTTGTGAATGTCCTGTTAAAGGCTGAACCAGATACTGATGAGGTGTATGCACAAGTGACTTTGATGCCGGAGCCAAATCAAGATGAGAATGCAGTGAAGAAGGAACCTATGCGCCCTCCTCCACCACGATTTCATGTACACTCTTTTTGTAAGACTCTAACAGCCTCTGATACAAGCACTCACGGTGGATTTTCTGTCTTGAGACGACATGCTGATGAATGCCTCCCCCAACTGGACATGTCTCGGCAGCCTCCCACACAGGAGTTGGTGGCCAAAGATTTACATGGAAATGAGTGGCGATTCAGGCATATATTCCGGGGCCAGCCTAGGAGGCATCTTCTTCAGAGTGGTTGGAGTGTCTTTGTTAGTTCGAAGAGGCTTGTTGCTGGGGATGCATTCATATTTCTTAGAGGTGAGAATGGGGAGCTTCGTGTTGGTGTTAGACGTGCCATGAGACAGCAAGGAAATGCTCCATCATCGGTGATATCCAGTCATAGCATGCATCTTGGTGTACTTGCAACAGCTTGGCATGCCATTCAAACAAAAACGATGTTCACTGTGTATTACAAGCCCAGGACAAGCCCTGCTGAGTTTATAGTTCCATATGACCACTATATGGAATCTGTGAAGAATAATTACTCTATTGGAATGAGGTTTAAGATGAGGTTCGAAGGTGAAGAAGCTCCAGAGCAAAGGTTTACTGGAACTATTGTTGGCATTGAAGATGCTGATCCCCAAAGGTGGCTTGAATCTAAGTGGAGATGTCTGAAGGTACGGTGGGATGAAAATTCAAGCATTCCAAGGCCAGACCGAGTTTCACCGTGGAAAATAGAACCAGCTCTTAGCCCTCCTGCACTTAATGTACCTCCAGTTGCAAGGCCAAAAAGGCCTAGATCCAGTATTTTGCCCACATCTCCTGATTCATCTGTCCTTACTAGGGAAGGTTCATCAAGAGCGACAGCAGACCATTCCCAAGCCAGTGGGTTTCCGAGGGTCTTGCAAGGTCAAGAGTTATCGACCTTTAGAGGCGGTTTTGCAGAAATTAATGAGACAGACTTGTCTGAGAAACCAATGATATGGCAAACATCAGTGAATGATGAAAAGAATGATATTCATTCTGCATCAAAGAGATATCTTCCAGATAAATGGCTACCTTTAGGGAGGCCTGAGTCATCTCTCACAGATTTGTTATCAGGTTTTGGCTCCTCCCATGGGTTCTGTTTACCCTCTGCGGACCAAGCTGCGTTTGGTGCTAGATTGGTGAAGCAACAAACACAAGATCAGGAAAAGGATTTTAGCTTATTGGGAAAGCCATGGTCTCTTCTGTCTTCCGGTCTCTCTCTTAATCTGATGGATTCTGGTTCAAAAGCTCCTGGCATAGGGGGTGATACTCCCTATCAAATGCGGGGAGATGCTAGGTATAGTGGTTATGGTGAGTTTTCAGTACTCCCCGGTCATAGGGTTGCAAATCAGCAGGGAAGCTGGATTATGCCTCAACCAGTGTCGCCTTACATGCAGCTCTCCTCTCATTCAAGAGAAATGATGCATAAACCCTCTGTAGTAAAGCAACCCGAGGCTGTGAAACCCAAAGAGGGTAACTACAAACTATTTGGCATTCCTCTTACAAGTAATGTTTGCACAGATGCTGTTATGATGCGGAAAAGTTCATTGATTGATCCAGCAAGTGACATGAATATTGGTATACACCCTCATCAATCCCTTGCCACTGATTCTGATCAAAGGTCTGAGCAATCAAAGGGATCAAAGGTGGATGATGGAGTTGCAGCTAATGATCATGACAAACAATTTCATACCTTTCATCTTGCTGCTAGAGACAAGGATGGCAAAGGGCATAGTAGTTCTACAAGGAGCTGCACAAAGGTTCATAAACAGGGTACAGCACTCGGAAGGTCCGTAGATCTTGCAAAGTTCAACAATTATGACGAATTGATTGCTGAACTGGATCAACTTTTTGATTTTAATGGTGAACTCAAGGCTCGGAGTAAGAGTTGGCTGGTTGTATACACTGATGATGAGGGTGACATGATGCTTGTTGGAGATGATCCATGGCAGGAATTTTGTGGTATGGTTCGCAAGATTTTCATCTATACAAAAGAGGAGGTGCAGCGTATGAATCCAGGGACCCTTAATTCAAAAGGTGAGGACACTTCTTCTGTTGCTGAGGGCTCAGACGCTAAAGAAGTGAAGAATCTGCAACTTCCTTCTGAATCTGGTCAAGCAGAATCTTAGGTTTTCCTCCAAAATTGAGGTTTATAAGATAGCGAGGAGATGGCTTTTATCCACCTAGGTGTTACTTTTTTGGGGATTTTTGAATATAACCTACAATATCAACTCCCTTTGACGTGTGGATGGGGATGGTCTCTTCATATAAATGCAGCTTCAGTATTTGCAGTTTTGAGCCTTTATTTGGAGCCAATATCTGGCCCCTTATCTATCTATATACATAGTATATGTAAATTATCAGCGTTGGTCATTAACGTTGCTTCTGCCAATCTCACTTTTGTACATACCAATTTCTCTAGCTGTAGCTGTAATTAAGATTTCGATTCTACTATGTATGTACCTGCCTTACTGTTGATTTTTGTGGAAGTGGTATCCAACTACTTTGGGCAGATAACATATTTTGTATCAGCAATTATGGTAATGTGATAGAAAAGAAGGTTTTTCTGAAAAAAAAAA

 

3329

 

37956

 

Contig6948

LC17BE04/LC14DA08/LC19CH11/LC14BA12/LC14AE05/LC16BE06/LC18DH09/LC08BA03/LC12DB06/LC16CE04/LC12DE04/LEFL2011O01/LC10DD11/sgn|E542991/LC07CF10/sgn|E302362/LEFL2004P11/LC03BG06/LC22CB04/sgn|E268768/sgn|E247625/LC06CC08/sgn|E331943/LC19CF04/sgn|E328568/sgn|E208671/sgn|E312029/sgn|E369963/sgn|E249090/LC15DH05/LC06BF03/sgn|E365676/sgn|E247696/sgn|E330373/sgn|E368958/sgn|E212872/sgn|E262657/sgn|E247943/sgn|E258071/sgn|E248483/sgn|E301498/sgn|E271541/sgn|E316272/sgn|E295878/sgn|E367427/sgn|E339156/LA18CC12/sgn|E341891/sgn|E204238/sgn|E250479/sgn|E265600/FA20AF03/sgn|E268619/sgn|E366588/sgn|E345301/sgn|E554180/sgn|E249568/sgn|E325848/sgn|E258742/FA36BB11/FA05BA06/sgn|E265788/sgn|E285251/sgn|E309995/sgn|E207970/sgn|E248016/sgn|E252813/sgn|E246366/LC09BA05/sgn|E323351/FA42CD01/sgn|E313187/sgn|E267998/sgn|E264625/FA24AF01/sgn|E254850/sgn|E285440/sgn|E274438/sgn|E272697/sgn|E249110/sgn|E261406/sgn|E272768/sgn|E274296/sgn|E276113/LC17DA09/sgn|E246555/sgn|E262057/sgn|E247492/sgn|E294543/sgn|E211909/sgn|E336945/sgn|E279098/FA36DE02/sgn|E344961/sgn|E263908/sgn|E279864/sgn|E293537/sgn|E293538/sgn|E281930/FA06AD12/sgn|E213610/sgn|E202621/LC11DD12/LB12DG04/sgn|E292724/sgn|E253308/sgn|E247905/sgn|E353588/sgn|E323471/sgn|E378470/sgn|E348393/sgn|E371435/sgn|E365710/sgn|E280435/sgn|E542990/LC03BA01/LC06AH04/LC18DG11/LC22DB07/LC17DH01/LC07DB03/LC06BB05/sgn|E234573/sgn|E397703/sgn|E348977/LC03AH08/sgn|E556374/LC14CD11/LC21CE04/sgn|E239028/LC03BF02/sgn|E239259/sgn|E368957/sgn|E352087/sgn|E352496/sgn|E349421/sgn|E349115/sgn|E344963/sgn|E350296/sgn|E369962/LC16CA05/sgn|E298795

3261

TC186716 UP|CLPAB_LYCES (P31542) ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast precursor, complete

3201

Show
Contig6948

Contig6948

 

LC17BE04/LC14DA08/LC19CH11/LC14BA12/LC14AE05/LC16BE06/LC18DH09/LC08BA03/LC12DB06/LC16CE04/LC12DE04/LEFL2011O01/LC10DD11/sgn|E542991/LC07CF10/sgn|E302362/LEFL2004P11/LC03BG06/LC22CB04/sgn|E268768/sgn|E247625/LC06CC08/sgn|E331943/LC19CF04/sgn|E328568/sgn|E208671/sgn|E312029/sgn|E369963/sgn|E249090/LC15DH05/LC06BF03/sgn|E365676/sgn|E247696/sgn|E330373/sgn|E368958/sgn|E212872/sgn|E262657/sgn|E247943/sgn|E258071/sgn|E248483/sgn|E301498/sgn|E271541/sgn|E316272/sgn|E295878/sgn|E367427/sgn|E339156/LA18CC12/sgn|E341891/sgn|E204238/sgn|E250479/sgn|E265600/FA20AF03/sgn|E268619/sgn|E366588/sgn|E345301/sgn|E554180/sgn|E249568/sgn|E325848/sgn|E258742/FA36BB11/FA05BA06/sgn|E265788/sgn|E285251/sgn|E309995/sgn|E207970/sgn|E248016/sgn|E252813/sgn|E246366/LC09BA05/sgn|E323351/FA42CD01/sgn|E313187/sgn|E267998/sgn|E264625/FA24AF01/sgn|E254850/sgn|E285440/sgn|E274438/sgn|E272697/sgn|E249110/sgn|E261406/sgn|E272768/sgn|E274296/sgn|E276113/LC17DA09/sgn|E246555/sgn|E262057/sgn|E247492/sgn|E294543/sgn|E211909/sgn|E336945/sgn|E279098/FA36DE02/sgn|E344961/sgn|E263908/sgn|E279864/sgn|E293537/sgn|E293538/sgn|E281930/FA06AD12/sgn|E213610/sgn|E202621/LC11DD12/LB12DG04/sgn|E292724/sgn|E253308/sgn|E247905/sgn|E353588/sgn|E323471/sgn|E378470/sgn|E348393/sgn|E371435/sgn|E365710/sgn|E280435/sgn|E542990/LC03BA01/LC06AH04/LC18DG11/LC22DB07/LC17DH01/LC07DB03/LC06BB05/sgn|E234573/sgn|E397703/sgn|E348977/LC03AH08/sgn|E556374/LC14CD11/LC21CE04/sgn|E239028/LC03BF02/sgn|E239259/sgn|E368957/sgn|E352087/sgn|E352496/sgn|E349421/sgn|E349115/sgn|E344963/sgn|E350296/sgn|E369962/LC16CA05/sgn|E298795

 

3261

 

TC186716 UP|CLPAB_LYCES (P31542) ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast precursor, complete

 

3201

 

6217

 

0

 

3157

 

99

 

3261

 

AK066153|Os12g0230100 ATP-dependent Clp protease ATP-binding subunit clpA homolog, chloroplast precursor (Fragment).

 

919

 

1355

 

0

 

918

 

77

 

3261

 

sp|P31542|CLPAB_LYCES ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast precursor

 

923

 

1597

 

0

 

923

 

91

 

3261

 

SGN-U312783

 

3234

 

6219

 

0

 

3158

 

99

 

3261

 

P31542|CLPAB_SOLLC ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast precursor - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)

 

923

 

1597

 

0

 

923

 

91

 

3261

 

AT5G50920.1 | Symbol: CLPC | Similar to ATP-dependent Clp protease ATP-binding subunit / ClpC, almost identical to ClpC GI:2921158 from (Arabidopsis thaliana): contains Pfam profile PF02861: Clp amino terminal domain: contains Pfam profile PF00004: ATPase, AAA family: contains Pfam profile PF02151: UvrB/uvrC motif. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC translocation machinery, | chr5:20732698-20737597 REVERSE | Aliases: K3K7.7, K3K7_7, ATHSP93-V, HSP93-V, CLPC

 

929

 

1410

 

0

 

922

 

81

 

ATCCGCTCTCCTCTCTTCTCCAATCCAGTCACCCTAATCCCATTTTCCTCTAAACCCATCTTCCCCTTTTCCATCTATATTCTTCAACAATCTCCCAGATTCTTCTGGGACTTCAGGTCCATCATGGCTAGAGCTCTAGTTCAGTCAACAAGCATCCCATCGTCAGTTGCTGGTGAAAGGACAACCAAATTCAATGGATCTGGGAAAACAAAAAGAGCTGTTACAATGCTATGCAATGCACAATCATCTTCACTTACACTGAGGGATTTTACAGGATTGCGAGGATGCAATGCAATAGATACACTAGTTAGATCTGGCCAAACTCTCCAATCCAAAGTAGCTGCTGCAACTTATGTCAGACGGCCACGAGGTTGCCGATTTGTACCAAAAGCAATGTTTGAGCGCTTCACAGAGAAGGCGATAAAAGTCATTATGCTTGCACAAGAAGAGGCCAGACGACTTGGTCACAATTTTGTTGGCACTGAGCAGATCTTGTTGGGTCTAATTGGTGAGGGAACTGGTATTGCTGCCAAGGTTCTTAAATCGATGGGGATCAATTTGAAAGATGCTCGTGTGGAAGTGGAAAAGATAATTGGAAGGGGTAGTGGGTTTGTTGCTGTTGAGATCCCTTTTACCCCTCGTGCCAAGCGTGTTCTGGAACTCTCTCTGGAGGAAGCCCGCCAGCTAGGGCATAACTATATTGGTTCGGAGCACTTGCTACTTGGATTGCTACGTGAAGGTGAAGGTGTGGCTGCCCGTGTTCTTGAAAACTTGGGTGCTGACCCCAGCAACATCCGCACTCAGGTGATCCGGATGGTTGGTGAGAGTAATGAGGCTGTTGGTGCTAGCGTTGGAGGTGGAACTTCTGGCCAAAAAATGCCAACACTGGAGGAGTATGGAACAAATTTGACAAAATTGGCGGAAGAGGGAAAATTGGACCCCGTTGTTGGAAGACAGCCGCAAATTGAACGGGTCACTCAAATCTTGGGTCGGCGGACTAAGAACAACCCTTGTCTTATTGGTGAACCAGGTGTTGGCAAAACAGCTATTGCTGAGGGTTTGGCACAAAGAATTGCAAATGGTGATGTCCCTGAAACAATTGAGGGGAAGAAGGTGATAACTCTTGATATGGGATTGCTTGTTGCTGGGACAAAATACCGTGGAGAGTTTGAGGAAAGGCTAAAAAAGCTGATGGAGGAAATTAAGCAGAGTGATGAAATAATACTATTTATCGATGAAGTGCACACATTGATTGGAGCTGGAGCAGCAGAGGGGGCCATCGATGCTGCAAACATCTTGAAACCTGCCCTAGCTCGAGGTGAACTACAGTGTATCGGAGCTACTACACTGGATGAATACAGAAAGCATATTGAGAAAGATCCTGCACTAGAGAGGAGATTCCAACCAGTTAAGGTCCCTGAACCTACTGTTGATGAAACTATACAGATTCTGAAAGGGCTTCGTGAGAGGTATGAAATTCATCACAAACTTCGTTACACTGACGAAGCCTTAGTGGCTGCTGCTCAGCTCTCATACCAGTACATCAGTGACCGATTTCTGCCTGACAAAGCAATTGATTTGATTGATGAAGCTGGTTCTCGTGTTCGACTTCGCCATGCTCAGCTCCCCGAGGAAGCAAAAGAGCTCGAGAAAGAACTTCGTCAGATAACAAAGGAGAAGAATGAAGCTGTTCGTGGTCAAGATTTCGAAAAGGCTGGGGAATTACGTGATAGAGAAATGGATCTGAAGGCACAGATCACAGCCCTCATAGACAAAAACAAAGAGGTGAGCAAGGCTGAAAGTGAGGCTGCAGATACAGGTCCACTTGTGACAGAAGCAGATATTCAGCACATCGTCTCTTCTTGGACTGGTATCCCTGTTGAGAAGGTCTCCACTGACGAATCTGACCGTCTCCTAAAAATGGAAGAAACACTTCACACACGAATCATTGGCCAGGATGAAGCTGTCAAAGCCATTAGTCGCGCTATTCGACGTGCACGAGTTGGGCTCAAGAATCCCAACAGACCTATTGCTAGTTTCATCTTTTCCGGTCCCACTGGTGTTGGGAAATCAGAACTGGCAAAGGCACTGGCTGCATATTACTTTGGTTCTGAAGAAGCAATGATCCGGCTTGATATGAGTGAGTTCATGGAAAGACACACTGTCTCTAAACTCATTGGATCCCCCCCTGGTTATGTTGGTTACACAGAGGGTGGTCAATTGACTGAAGCTGTTAGGCGTCGACCTTATACAGTTGTGCTCTTTGATGAGATTGAGAAGGCTCATCCTGATGTCTTCAACATGATGCTTCAAATTCTTGAAGATGGAAGATTGACAGACAGCAAGGGTAGAACTGTAGATTTCAAGAACACACTTCTCATCATGACATCAAATGTTGGAAGTAGTGTAATTGAGAAAGGTGGCCGTCGTATAGGTTTTGATCTCGACCTTGATGAGAAGGATAGCAGTTACAATCGCATCAAGAGCTTAGTGACAGAAGAATTGAAGCAGTACTTCAGGCCAGAGTTTTTGAACAGATTGGATGAGATGATTGTATTCCGTCAGCTCACTAAGTTAGAGGTTAAGGAGATAGCTGATATCATGCTTAAGGAGGTCTTTGAGAGGTTGAAAGTTAAGGAGATAGAACTTCAAGTGACAGAGAGGTTTAGAGACAGGGTGGTTGACGAGGGATACAACCCTAGCTATGGAGCACGACCTCTGAGAAGAGCTATTATGAGACTTTTAGAGGACAGCATGGCTGAGAAAATGCTTGCAAATGAGATTAAAGAAGGTGATTCAGTTATCGTGGACGTTGATTCAGATGGCAATGTGACTGTCCTCAATGGAAGTAGTGGTACTCCCTCGGATCCGGCTCCTGAGCCTATCCCCGTTTAGATCAGGTGATCACATTTTAGCTCAACAGTCTCTGTGTGGTCTTTTAAGAGTTCATTTGTGTTGGCCACTAAGCTTTGTGGGGCTTATGAAGCAACTTTTGAGTTTATCTCTGGGAATGCTCAGGTAAATCTTGCCACGTCGAGAAGGCAGCATCCTTTCTATGTTGATCTTTAATGATTTTACAGAAGTATACTGGATTAAGATTGTAGTTGGTCACAAGAAAGTATTGTATTAACAAGACACTCCTTATCAAAAAACATATCTAGTTTATTGTAGGCGACAGTTGAATCGTTAACCAAAAAAAATCTAATGTAGTTATCTGCGCTTAAAAAAAAAACTCTTTTAAAAAAAATAAAAAAAAAAAAA

 

3261

 

29632