KTU2ID EST VS_LGI_EntryLength VS_LGI_Subject VS_LGI_Sbjct_Length

Singlet9999

LEFL2016G18

757

No hits found

0

Show
Singlet9999

Singlet9999

 

LEFL2016G18

 

757

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

757

 

AK067708|Os02g0820300 TPR-like domain containing protein.

 

621

 

67

 

2.00E-11

 

121

 

32

 

757

 

ref|NP_850163.1| unknown protein [Arabidopsis thaliana]

 

617

 

147

 

5.00E-34

 

155

 

53

 

757

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

757

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

757

 

AT2G31240.1 | Symbol: None | tetratricopeptide repeat (TPR)-containing protein, contains Pfam profile PF00515: TPR Domain | chr2:13324492-13326637 REVERSE | Aliases: F16D14.8, F16D14_8

 

617

 

147

 

6.00E-36

 

155

 

53

 

GATGAGGGATTGAACAACCTTAGAGCCAAGGGTTTTTGCAGGGTTTAACAGAAACAAAATACGAGAGGTTAAGATTATTATCATGAGGAAAGTTTCATCTTTTGCTGTTCCACATCTCCAGGCGTACACCAAAACTTCATTCTCTCTCATTTCTAAAGACTTAATCTCCCACTTTTCTTCTCTCCCTACCACCAGCACCAACCCCATCAATGGAAATCAACAAATTTCCCCTCAATTATCAAACACACATCTCAAATCTTGCAGCAAGACTCAATTTTTACATTTATCCAATTTCAAAATACAGCAATCCCAAAGTTTCAACACACTTGTGGAGCAAAACCCATCTCAGTTGTCTTCAAGACAGAGAAAGATTAGAGAAAGATCACAACTTGAAGAGGCTTTTGAGTCAGCAAAGACTATGCAAGAAATGCTTCAGGTTTTTCAAGAAATGGAGGTAAGTTTTGATGAGAGGGAACTTGGTTTGCCATGTTTAAGAATAGGTCTCAAACTTGACCAAGAAGGTGAGGATCCTGAAAAGGCTCTGTCTTTTGCTAATAGGGCTTTGAATGTATTGGATAGAGATGATAAATTGTCTTTGCCTCTTGCCATGACTTTGCAATTGTTGGGTTCTACTTGTTATAGTTTGAAAAGATTTAATGATAGTTTGGGGTATCTTAATAGGGCTAATAGGGTTCTGGATAAATTAGTTAAGGATGGTTC

 

720

 

9999

 

Singlet9998

LEFL2016G09

615

TC174602 homologue to UP|Q84UU0_9SOLA (Q84UU0) Photosystem I subunit XI, partial (95%)

706

Show
Singlet9998

Singlet9998

 

LEFL2016G09

 

615

 

TC174602 homologue to UP|Q84UU0_9SOLA (Q84UU0) Photosystem I subunit XI, partial (95%)

 

706

 

777

 

0

 

392

 

100

 

615

 

AK119162|Os12g0420400 Photosystem I reaction center subunit XI, chloroplast precursor (PSI- L) (PSI subunit V).

 

208

 

141

 

4.00E-34

 

108

 

66

 

615

 

gb|AAO85557.1| photosystem I subunit XI [Nicotiana attenuata]

 

220

 

198

 

2.00E-49

 

108

 

87

 

615

 

SGN-U312652

 

878

 

733

 

0

 

370

 

100

 

615

 

Q39654|PSAL_CUCSA Photosystem I reaction center subunit XI, chloroplast precursor (PSI-L) (PSI subunit V) - Cucumis sativus (Cucumber)

 

217

 

162

 

6.00E-40

 

108

 

74

 

615

 

AT4G12800.1 | Symbol: None | photosystem I reaction center subunit XI, chloroplast (PSI-L) / PSI subunit V, identical to Photosystem I reaction center subunit XI, chloroplast precursor (PSI-L) (PSI subunit V) (Swiss-Prot:Q9SUI4) (Arabidopsis thaliana): contains Pfam profile PF02605: photosystem I reaction center subunit XI: contains 2 transmembrane domains | chr4:7521319-7522667 FORWARD | Aliases: T20K18.150, T20K18_150

 

219

 

160

 

7.00E-40

 

108

 

75

 

GTATTCTGATCGAACAAACAGCAGTACTGCCAAACAATACTTTTCCAAAATGGCTACTGCAGCATCCACAATGGCTAGCCAGTTGAAGAGCAGCTTTGCTTCGTCTTTAACCAAAGGCCTCGGCCTTGTCACTCCCAAAGGCATTACTGGTGCACCTTTAAAGATTTTCCCTTCAACAAGAAAGTCTTGCTTCACCGTCAAGGCTGTCCAAGCTGATAAACCTACTTTCCAAGTGGTTCAGCCCCTTAATGGTGACCCTTTCATTGGAAGTCTTGAAACTCCAGTCACCTCAAGTCCATTGATTGCATGGTATCTCTCCAACTTGCCTGCCTATCGGACCGCGGTGAACCCACTTCTCCGGGGAGTAGAAGTGGGCCTGGCCCATGGATTCTTTTTTGGTGGAAGTTCTGGTGTCACTTGGGCTTATTTCCTCCTTTATGTCCTTGATCTTCCTTACTTTGTTAAGTAAATTTCGTTAATTGATGTAACTATACATTATCAATGTTAAATTGTATATTGAACTACTAAGCTCTTGGAGGACTGCAATTTAACTCGTTGTAACGAAAAAAAAAA

 

573

 

9998

 

Singlet9997

LEFL2016G06

169

No hits found

0

Show
Singlet9997

Singlet9997

 

LEFL2016G06

 

169

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

169

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

169

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

169

 

SGN-U339874

 

983

 

155

 

1.00E-37

 

86

 

97

 

169

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

169

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TGACTTTATGATTACTTACATGTGCTTATCTATTTTAGTCCTGTTATAATTACTTCTTTTTGGAAATTTCAACTTGAATTTTGTGATGATTTCTGCAGCAAGTTTTACTTCTACTGAATGTATTGCTGCTGAATCCCTTTGACAATTCTCTCATTTTGCATGTCTCATC

 

169

 

9997

 

Singlet9996

LEFL2016F20

298

No hits found

0

Show
Singlet9996

Singlet9996

 

LEFL2016F20

 

298

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

298

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

298

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

298

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

298

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

298

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GGTGGACTCCTCAGCTACTAAATACTCCATTTTTTTTCTCTTCTATCTCTCTGTCTCTCTCTTTCATACAGAGTACTGATTGTGTTTGTTGTGTTCTTCTTCACCATCACTTGCAGACAAACAAGAAATTAAAAACCCTTGTAAAACCCTAAAAAAAGATTCCAACTTTTACAGTTTCAACCCCATTTTTAACTTATTTTGTTTATTGTGTGGTTAAAGTTTTTAAAAAATTAAATATTTGTGAAGTTTATCAAC

 

255

 

9996

 

Singlet9995

LEFL2016F15

547

No hits found

0

Show
Singlet9995

Singlet9995

 

LEFL2016F15

 

547

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

547

 

AK106859|Os07g0103500 2OG-Fe(II) oxygenase domain containing protein.

 

341

 

122

 

2.00E-28

 

141

 

43

 

547

 

gb|AAO92303.1| gibberellin 2-oxidase 1 [Nicotiana sylvestris]

 

354

 

191

 

1.00E-47

 

143

 

66

 

547

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

547

 

O49561|G2OX8_ARATH Gibberellin 2-beta-dioxygenase 8 (EC 1.14.11.13) (Gibberellin 2-beta-hydroxylase 8) (Gibberellin 2-oxidase 8) (GA 2-oxidase 8) - Arabidopsis thaliana (Mouse-ear cress)

 

293

 

98

 

2.00E-20

 

106

 

47

 

547

 

AT4G21200.1 | Symbol: None | oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to gibberellin 20-oxidase from A. thaliana (gi:1109699), Phaseolis vulgaris (gi:2262201): contains Pfam domain PF03171, 2OG-Fe(II) oxygenase superfamily | chr4:11302761-11306611 FORWARD | Aliases: F7J7.140, F7J7_140

 

293

 

98

 

3.00E-21

 

106

 

47

 

GAGAGAGGCACCACAAAAAATGCTATATATATTCTACATTTTTCTGGTGAATTTCATGTGATGTTATCTGACACCACATTTCTTTTCACACCATAAGCATGGAAGAATCACCTGATCCTCCATTTGTGGAGACATACAAAAATCTTATTGATACCAATATAGTCGATGATGAACACATTGACCTATTCATGGTGGAAGAATGCGAGTTGCCTTTGATAAATCTTCATCAACTTAACTATGGAAACAAATTCGAGAGAGAAAAATGCAAGAAGAACATAGCCAAGGCATCGCGAGAATGGGGTTTTTTCCAAGTGGTGAACCATGGAGTTTCACCTAATATTTTGGGACAAATGAGGACGGAGCAAGTCAAGCTTTTCAAGAAAACGTTCAATGAAAAGATAAATATTGATAAAAGTCTTAATTTCTCCGAAGGAAGTTACCGTTGGGGAACGCCAACGGCGACTTGCCTTCGGCAGATTTCATGGTCAGAAGCTTTTCATGTACCTCTCT

 

510

 

9995

 

Singlet9994

LEFL2016F13

35

No hits found

0

Show
Singlet9994

Singlet9994

 

LEFL2016F13

 

35

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

35

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

35

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

35

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

35

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

35

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

AGCGAGTCGAG

 

11

 

9994

 

Singlet9993

LEFL2016F07

36

No hits found

0

Show
Singlet9993

Singlet9993

 

LEFL2016F07

 

36

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

36

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

36

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

36

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

36

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

36

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

TAGCGAGTCGAG

 

12

 

9993

 

Singlet9992

LEFL2016F01

631

TC182479 homologue to RF|NP_001031270.1|79321186|NM_001036193 GTP binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (97%)

1292

Show
Singlet9992

Singlet9992

 

LEFL2016F01

 

631

 

TC182479 homologue to RF|NP_001031270.1|79321186|NM_001036193 GTP binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (97%)

 

1292

 

242

 

2.00E-63

 

142

 

97

 

631

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

631

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

631

 

SGN-U318880

 

1756

 

254

 

6.00E-67

 

140

 

97

 

631

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

631

 

AT1G72660.3 | Symbol: None | similar to developmentally regulated GTP-binding protein (DRG1) [Arabidopsis thaliana] (TAIR:At1g17470.1): similar to developmentally regulated GTP binding protein [Pisum sativum] (GB:AAB67829.1): contains InterPro domain Small GTP-binding protein domain (InterPro:IPR005225): contains InterPro domain TGS domain (InterPro:IPR004095): contains InterPro domain GTP1/OBG domain (InterPro:IPR006074): contains InterPro domain GTP1/OBG (InterPro:IPR006073): contains InterPro domain GTP1/OBG sub-domain (InterPro:IPR006169) | chr1:27357542-27360332 FORWARD | Aliases: None

 

399

 

47

 

9.00E-06

 

23

 

100

 

GTCGAGCATACACTATCGTCTACTTACACACGACCCGTCGCATATCATCGCCGGTACGGTCACCGGAGTTGAAAATATCTTCTCGTCTTTCAGGAAAACTAAGGAACCATGGGGATCGTAGAAAGGATTAAAGAAATAGAAGCTGAGATGGCTCGTACACAAAAGAATAAAGCAACTGGTAACTGTTTACTAAAGCCTTTTTGACAGTTGTGTTTCTACCATCGTTATTTGAAGTGCCATTCACGTTACTATTAAGCACAACCTTGTGAACAGATACATTACCTTTTCTTTTTCTCCTGAGTCCTCCTAGAACCTTGTTAAAGCGATCTGCTGTCTGGAGGAGCAACTCTTGTTACTATCTTTAAAAAATAATAGAAAGAGAGAAATATGTGTGGATGCAAAGTAAATATTATCTCTGCGGTCTACGGAAACACCCCCCCACCCCTCACCCCCCAAGTGATGCATAATTAACTCCAATCATTACTTACATACTTCTACAGTAAGCCTAACTCAAATTTTAATAATTTGTAGTGACACACCCCAAAAAACATTAAAATGAACTTATTTTGACTGATAGGACAGGCCCGAGAACTC

 

594

 

9992

 

Singlet9991

LEFL2016E22

636

TC177310 weakly similar to RF|NP_001006204.1|57525247|NM_001006204 signal recognition particle 68kDa {Gallus gallus} (exp=-1: wgp=0: cg=0), partial (11%)

1023

Show
Singlet9991

Singlet9991

 

LEFL2016E22

 

636

 

TC177310 weakly similar to RF|NP_001006204.1|57525247|NM_001006204 signal recognition particle 68kDa {Gallus gallus} (exp=-1: wgp=0: cg=0), partial (11%)

 

1023

 

549

 

1.00E-156

 

277

 

100

 

636

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

636

 

ref|NP_568947.1| unknown protein [Arabidopsis thaliana]

 

605

 

76

 

1.00E-12

 

95

 

47

 

636

 

SGN-U316427

 

2086

 

349

 

1.00E-95

 

300

 

90

 

636

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

636

 

AT5G61970.1 | Symbol: None | signal recognition particle-related / SRP-related, low similarity to Signal recognition particle 68 kDa protein (SRP68) from Homo sapiens SP:Q9UHB9, Canis familiaris SP:Q00004 | chr5:24905843-24910554 FORWARD | Aliases: K22G18.11, K22G18_11

 

605

 

76

 

2.00E-14

 

95

 

47

 

CAGAAAACGCTCCGCCGTAAGCTCGACAATGGCAAAGCAGAAGGAAACTTCCGCCATGGAAATTGACGATCAGAGTTCTATTCCTTCTGATCAGATCAGTAACCCTAAGTTCTCCGTCAATGTGTTACAACTTTTAAAATCTGCTCAAATGCAGCATGGATTGCGATTCGGCGATTACGCTCGTTATAGGAGGTATTGTACGGCTCGATTAAGGAGATTATATAAATCGCTCAAGTTCACTCACGGACGTTTGAAGTACACTAAGCGTCCAATATCAATAACTACGGTTACTGAAGTGAGGTGTGTGCTTTTGTATTTCGTTTGTGATGTTTCTATACATAGTGTTAATTTGGTTTACTATTCAAGTGATGGATTGGTTGTGTTTTGTCCTATGAAGTAAGAGAACCCTATCATGCCACAACATATAGAAATGTGTCTTGAAGATTGTATTACTTATTACAACAACAAAAATTACCTTTCATTCTCAAACTAATTAGGACCAATTATATGAAGTCTCTACATTTTGTTCGGTCCAACTGTGATGTCTGGGCCACCTTGCGTGTGGCTCAACTATTCAACCGCATACTTGCTACCTCCTA

 

599

 

9991

 

Singlet9990

LEFL2016E21

128

No hits found

0

Show
Singlet9990

Singlet9990

 

LEFL2016E21

 

128

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

128

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

128

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

128

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

128

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

128

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GTATATCCCCCACTTCCCATGTCTTTCTTCACATCTTCCACCAAAAAAAAAA

 

52

 

9990

 

Singlet999

FA35DC02

527

BP886908

457

Show
Singlet999

Singlet999

 

FA35DC02

 

527

 

BP886908

 

457

 

906

 

0

 

457

 

100

 

527

 

Os03g0736200|Os03g0736200 Protein prenyltransferase domain containing protein.

 

406

 

51

 

5.00E-07

 

53

 

43

 

527

 

gb|ABE65780.1| pentatricopeptide repeat-containing protein [Arabidopsis thaliana]

 

458

 

60

 

5.00E-08

 

54

 

53

 

527

 

SGN-U329581

 

1931

 

938

 

0

 

473

 

100

 

527

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

527

 

AT1G77405.1 | Symbol: None | pentatricopeptide (PPR) repeat-containing protein, contains Pfam profile PF01535: PPR repeat | chr1:29092039-29093415 FORWARD | Aliases: F2P24.16, F2P24_16

 

410

 

60

 

7.00E-10

 

54

 

53

 

ATTTTGGAATTCCAAGAGAATATACTTATAAACTAGTTCGTGATGCTTTAGAATCTTCTGGGAAGATTGATTTGCTTGATGAAGAATTGTGTACAAGATTAGAAGATGGTATTAAAGGTAGGATTAGACAAGTGATGAAAGTTAAACCTTTGTTGCAGCATCAAACTGTTTCATCGCATTAAATTTTATACTTTTTATCTATGTTGCTCAGACTCTTCGAAAATGTTGATGGTTGTGTGTTGGATTCTCCGAAAGTAGTGTATATTTGGAGAATTTGACACTGATGCAACATTGAAAGTGAAGAGTTCACACAACTTAAACTTTTTATGGATTTAGATCTTATAAAAGCACAAGGGATTTAACTTATATACTGTTAGGCACTGCTGATACACGTGTTACGTCATAACGTAGCTTCTAGATGAGAAAAGAATGTTAGCAGTTTCAACTTTTTCTATCTAGTTGTTCTCTGCTTCTGCCATA

 

480

 

999

 

Singlet9989

LEFL2016E15

608

BP907277

466

Show
Singlet9989

Singlet9989

 

LEFL2016E15

 

608

 

BP907277

 

466

 

363

 

1.00E-100

 

183

 

100

 

608

 

AK068173|Os05g0144300 Type III restriction enzyme, res subunit family protein.

 

1128

 

70

 

1.00E-12

 

121

 

38

 

608

 

ref|NP_187252.1| ATP binding / ATP-dependent helicase/ DNA binding / helicase/ nucleic acid binding [Arabidopsis thaliana]

 

1132

 

78

 

2.00E-13

 

109

 

42

 

608

 

SGN-U346018

 

1193

 

396

 

1.00E-110

 

208

 

99

 

608

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

608

 

AT3G06010.1 | Symbol: None | homeotic gene regulator, putative, similar to SP:P25439 Homeotic gene regulator (Brahma protein) {Drosophila melanogaster}: contains Pfam profiles PF00271: Helicase conserved C-terminal domain, PF00176: SNF2 family N-terminal domain | chr3:1802441-1807290 REVERSE | Aliases: F2O10.3, F2O10_3

 

1132

 

78

 

3.00E-15

 

109

 

42

 

CGGGGAAAAAGAAAAGGGCAGACTCGTTTATTAAGTTTTTGGTTTAATAGTTTTTAACAAAAATTCAAATTCTCCAAAAAGAAATACAAAAACAGTCCTCTTCGCGCGCTGTTGTTAAGCCTGACAGCACCGGTGGGAGGACTCATGGTGGCTCAGATAGAGACCAACGCCGCCGCTGACGGTGGTGGAGGAGGAGGAGGAGGAGGAATGGTTGGAGGTTCTTCCCCTCCCGTTGATGANTCGCAGGAACAGTTAGAGAAGACGAAGACATTGATTTGTGCTCTCAATTTCCTCTCACGTAATCTTCCGATACCTCCTGACGTATTCGATGCTGTCTCTTCAATTTACAATAGCGACGCCAACGATGTTGATGTCGGTGACGGAGATGCATCCCCTGCTGACGTGGACAGTTTGTCTGTGCAAAATGGTCCAGGAATGGGAAGTTATGGAGACCTGATGGCAGATTTAGAGGAGTCGTTGTTGAGCCAACGGTCAAGTTATACATCAGGTTCTGGTTTGACAAAATTAAAGGAAGATCGTTTCCGAAGCCATATCCAGCATCGCCTAAC

 

569

 

9989

 

Singlet9988

LEFL2016E02

730

No hits found

0

Show
Singlet9988

Singlet9988

 

LEFL2016E02

 

730

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

730

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

730

 

emb|CAB43850.1| hypothetical protein [Arabidopsis thaliana]

 

1966

 

143

 

7.00E-33

 

240

 

37

 

730

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

730

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

730

 

AT4G30150.1 | Symbol: None | expressed protein | chr4:14742458-14749993 FORWARD | Aliases: F6G3.180, F6G3_180

 

2009

 

143

 

9.00E-35

 

240

 

37

 

GGTATTTCTAATGAAAATCTAGACTTATGGATATCATTGATTAGTGTGGTGCTTGAATTTCTCCGAAAGGTCCTCAATGATAAGCTCGATGGAACGAAGGCGGGTATTTTTGCCAAGCAGTTGTCTTGCTGCTTGCTTGAGCCATTTGTTAAGTTTCTAAAGGTCCATCCAACTCGTAAAAATGGTTTCCGCGAGTTTATAGATAAGCTTTTTGAAGATTTGGTGATTGTGTGGGATGTGTTAGATGTTCATGGCTGTGAAAGCAATCCAGAATGGAAAAGAAATCTATTGGTGTTGATAGAAGAAGTTTTGTCACAGGCATTATTCCATCCAACTCATATTGATGGATTTTTGAGCCTCCAAAGTACATCCAAATATAGGCATTCCGATGATAAAAAATCAAAAGAGGAGAAAACTTTCATAAAAAGTTACCATAGACACTTATTTGATAAGTTGGGGAAGATTATAACTGGGAAGAATGAGTCAGCACTCAGTGGTGCTGGAGAGCTGCTTCGTCTGTTCATTAATTGTATTTATATGAAGAATGGGGTTGTAGTCGGTGCAGAAGCATTTAGACACCAGGAAGGCAATTCTACTGCTTTTTCCAGGAGCTCTTCCAACAGCTCTGCGATCTCAACAAGTCCTCCCCAATATGCTCTGCCTGCAGAAGCACGGAAATCAGTTTTTGATTTT

 

693

 

9988

 

Singlet9987

LEFL2016E01

712

BW686007

644

Show
Singlet9987

Singlet9987

 

LEFL2016E01

 

712

 

BW686007

 

644

 

741

 

0

 

378

 

99

 

712

 

AK121970|Os03g0114300 Protein kinase domain containing protein.

 

741

 

81

 

8.00E-16

 

63

 

63

 

712

 

emb|CAB51653.1| putative protein [Arabidopsis thaliana]

 

710

 

89

 

1.00E-16

 

50

 

78

 

712

 

SGN-U317107

 

3231

 

644

 

0

 

329

 

99

 

712

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

712

 

AT4G24100.1 | Symbol: None | protein kinase family protein, contains eukaryotic protein kinase domain, INTERPRO:IPR000719 | chr4:12515086-12519851 FORWARD | Aliases: T19F6.90, T19F6_90

 

709

 

89

 

2.00E-18

 

50

 

78

 

ACTATCGATAATTTGTCATAGAATAGTTCATTTGTGAGCTACATTCAACTGCCAATACTTTCTCCGATGCTCTTCCGTCAACTTCAACGGCCATTTCCACAATCGGCAACTTATACTTCACTTTTATAACAAAGCGATTTTGCTTATTCGGTCCCAGCGGCGATGGGCGGCGGCGGTCCCAGAAATTATTCGGCGAATCCAAATGATTACAAGCTTCTCGAAGAAGTCGGTTATGGAGCGAGTGCAACAGTTTATAGAGCGATCTATCTTCCTTACAATGAAGTTATCGCAGTCAAGTGCTTGGATCTCGATCGCTGTAACAGCAATCTGGTTTGTCTATATTTCTTCTGCTTTCTGCTCTCTCAGTTTACTGATGGAAATAATTGACTTTGACTTGCGGATTAATTGATTTTTTGCTTTGTGATTTCTAGTATAGAATGATAGATGTTGTTTTAGTTTATCTTTATGGATATAGGTGGTTAGAATTGCAAATTGGCTATAGAGATCATAGAGTCGAAAGGACGTGGCTTCAATTGTGATTTCCTTGTTTGCTTTGACTTGTCATACGTCCGTGTTTTTACTCCTTGTATTTTGTCAGCAGTCAATATAACAAGACTCAATTCTGGTGTCTCCAAGTGATGTGATTGAACAAAGTTACTGATTTTACCCTGCGCA

 

675

 

9987

 

Singlet9986

LEFL2016D24

740

TC184553 UP|Q8RW34_LYCES (Q8RW34) Beta 1,3-glycosyltransferase-like protein I, complete

1554

Show
Singlet9986

Singlet9986

 

LEFL2016D24

 

740

 

TC184553 UP|Q8RW34_LYCES (Q8RW34) Beta 1,3-glycosyltransferase-like protein I, complete

 

1554

 

591

 

1.00E-168

 

298

 

100

 

740

 

AK069501|Os08g0386700 Beta 1,3-glycosyltransferase-like protein I.

 

343

 

72

 

5.00E-13

 

60

 

58

 

740

 

emb|CAD30015.1| beta 1,3-glycosyltransferase-like protein I [Solanum lycopersicum]

 

343

 

119

 

2.00E-25

 

60

 

100

 

740

 

SGN-U317280

 

1572

 

591

 

1.00E-168

 

298

 

100

 

740

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

740

 

AT5G53340.2 | Symbol: None | similar to galactosyltransferase family protein [Arabidopsis thaliana] (TAIR:At2g25300.1): similar to putative Avr9 elicitor response protein [Oryza sativa (japonica cultivar-group)] (GB:XP_482156.1): contains InterPro domain Glycosyl transferase, family 31 (InterPro:IPR002659) | chr5:21658039-21660711 REVERSE | Aliases: None

 

337

 

66

 

2.00E-11

 

60

 

60

 

TGATCGAAAATCTAGGCAATTCAATCAGCTCCGATCAGTCTAAATTCATCCGATATCAATCGACGTATCCGGCCGCTGACGAGTACTGATCCGTCGGAGTCGACGACGTATAGTAGAAATGAATAGCAGGGGTTCCGCCAACCGGTTATCATCCACCTCCAATTTCCGATCTCGAATCTCGTTTCTAATGCTCTCTATGTTCTCTACAATGGCTGCTCTTTATGTTGCCGGCAGGTTGTGGATGGACTCGGAGAATAGGGTATATCTTATTCAAGAGCTTGATAGGAGAACCGGACAGGTATTTTCTCTCTAATGGTAATATTGTTCTATTCATGTGGTAGATAAAGCTGATTCATTTTCCCTGAATTCTCCTGTCATCTTTGTTTTAGTAAGTTGTAGTATGTAGGATCAAATAAGCTCTATAAAGATCAAGGTGGTTGTCATGTGAGGATTATAATAGCTGACCATGAGGTAGTCTCCTTGATCTGAATATAGAATATGATTGATTATAAAGAAAATACAAGGTTCCACATTATCAAATGTTAACTAGCCATCTGTATAGGTTTGGTGAAGAGTGCATTTCCCTCATGTAAGACTCAACATTGTCACAAGTTTTACTTGGGCTAATCTGCTAGAACTTCACCCAAGTTGAGGAACCCCCAACCGTGCACCAATAAGATCACCAAAAGCCTTTTATGCCT

 

701

 

9986