Singlet9989

Singlet9989

 

LEFL2016E15

 

608

 

BP907277

 

466

 

363

 

1.00E-100

 

183

 

100

 

608

 

AK068173|Os05g0144300 Type III restriction enzyme, res subunit family protein.

 

1128

 

70

 

1.00E-12

 

121

 

38

 

608

 

ref|NP_187252.1| ATP binding / ATP-dependent helicase/ DNA binding / helicase/ nucleic acid binding [Arabidopsis thaliana]

 

1132

 

78

 

2.00E-13

 

109

 

42

 

608

 

SGN-U346018

 

1193

 

396

 

1.00E-110

 

208

 

99

 

608

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

608

 

AT3G06010.1 | Symbol: None | homeotic gene regulator, putative, similar to SP:P25439 Homeotic gene regulator (Brahma protein) {Drosophila melanogaster}: contains Pfam profiles PF00271: Helicase conserved C-terminal domain, PF00176: SNF2 family N-terminal domain | chr3:1802441-1807290 REVERSE | Aliases: F2O10.3, F2O10_3

 

1132

 

78

 

3.00E-15

 

109

 

42

 

CGGGGAAAAAGAAAAGGGCAGACTCGTTTATTAAGTTTTTGGTTTAATAGTTTTTAACAAAAATTCAAATTCTCCAAAAAGAAATACAAAAACAGTCCTCTTCGCGCGCTGTTGTTAAGCCTGACAGCACCGGTGGGAGGACTCATGGTGGCTCAGATAGAGACCAACGCCGCCGCTGACGGTGGTGGAGGAGGAGGAGGAGGAGGAATGGTTGGAGGTTCTTCCCCTCCCGTTGATGANTCGCAGGAACAGTTAGAGAAGACGAAGACATTGATTTGTGCTCTCAATTTCCTCTCACGTAATCTTCCGATACCTCCTGACGTATTCGATGCTGTCTCTTCAATTTACAATAGCGACGCCAACGATGTTGATGTCGGTGACGGAGATGCATCCCCTGCTGACGTGGACAGTTTGTCTGTGCAAAATGGTCCAGGAATGGGAAGTTATGGAGACCTGATGGCAGATTTAGAGGAGTCGTTGTTGAGCCAACGGTCAAGTTATACATCAGGTTCTGGTTTGACAAAATTAAAGGAAGATCGTTTCCGAAGCCATATCCAGCATCGCCTAAC

 

569

 

9989