Singlet31

Singlet31

 

FA03CC04

 

509

 

BP876062

 

474

 

674

 

0

 

340

 

100

 

509

 

AK071472|Os03g0826400 RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.

 

312

 

231

 

2.00E-61

 

158

 

71

 

509

 

ref|NP_190296.1| RNA binding / nucleic acid binding [Arabidopsis thaliana]

 

352

 

233

 

3.00E-60

 

158

 

71

 

509

 

SGN-U343419

 

1270

 

674

 

0

 

340

 

100

 

509

 

Q9Y388|RBMX2_HUMAN RNA-binding motif protein, X-linked 2 - Homo sapiens (Human)

 

322

 

167

 

2.00E-41

 

113

 

65

 

509

 

AT3G47120.1 | Symbol: None | RNA recognition motif (RRM)-containing protein, contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM) | chr3:17362126-17363807 REVERSE | Aliases: F13I12.170

 

352

 

233

 

5.00E-62

 

158

 

71

 

ATCCGTTGACGCTAGTGAAGCGTATTCAAAATATTAATGCAAAAGAAGCATCTTTAGGGATCTCCGATCAGGCATCCTGGCATGCTAGATACAAAGATTCAGCTTATGTATTTGTTGGCGGAATTCCTTTTGACCTCACTGAAGGTGATCTCCTAGCTGTTTTCGCCCAGTATGGGGAGGTTGTTGATGTCAATCTTGTTAGAGATAAAGGTACTGGCAAGTCAAAGGGTTTTGCTTTTGTTGCTTATGAGGATCAAAGGAGTACGAATCTCGCTGTGGATAACTTAAACGGTGCTCAGATCCTGGGTAGAATAATCAGAGTCGATCATGTTACCAACTATAAAAAGAAAGAAGAAGAGGATGAAGAGACAGAGAGGAAAAAGAGGGAGGAGCGAGGGGTCTGTCGTTCTTTCCAGAGGGGTGAATGCAATCGTGGTGCTGCTTGCAAGTTCTCTCACGATGAGAAGAGAGCTGCAAA

 

478

 

31