Singlet29

Singlet29

 

FA03CA07

 

518

 

TC179724 similar to UP|Q9SII5_ARATH (Q9SII5) Expressed protein (At2g17230/T23A1.9), partial (35%)

 

690

 

916

 

0

 

462

 

100

 

518

 

AK064235|Os07g0496700 Phosphate-induced protein 1 conserved region family protein.

 

327

 

125

 

2.00E-29

 

124

 

50

 

518

 

ref|NP_565797.1| unknown protein [Arabidopsis thaliana]

 

323

 

162

 

6.00E-39

 

134

 

59

 

518

 

SGN-U331223

 

770

 

916

 

0

 

462

 

100

 

518

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

518

 

AT2G35150.1 | Symbol: None | phosphate-responsive 1 family protein, similar to phi-1 (phosphate-induced gene) (Nicotiana tabacum) GI:3759184: contains Pfam profile PF04674: Phosphate-induced protein 1 conserved region | chr2:14824126-14825290 REVERSE | Aliases: T4C15.11

 

323

 

162

 

1.00E-40

 

134

 

59

 

CGGTACAATAAGTTTCATTTTTTTCATTATCTCCATTTCTTCTTGCTTCTATCTTCATCTTGCTTTTCACTTGTTGCCTTCTCTTGGATTCCATATAATGAAAACAAGAACTATGAAGGCTCCTCTGATCTTGTTAATCTTGAATACCATATGGGACCTGTTCTTTCTTCTCCTATTAAACTTTATGTGATATGGTATGGCCATTGGAACCCTTCTCATCAAGCCACAATTAGAGACTTTCTTAACTCCTTTTCATCTTCTTATGCACCTCATCCTTCTGTAGCTGATTGGTGGCGAACCGTTCGTCTTTACACAGATCAAACTGGCCAAAACATCTCAACTATTTCACTTTCTGGTGAATTCTTTGACTATAAGTACTCACAAGGGAAGTACCTTAGCAGATTATCAATGCAATATGTGATCAAGAATGCAGTAAGATCATACCGTGAATCTATACCGTTAAATTATAAGAATGGAGTTTACTTA

 

486

 

29