Singlet19

Singlet19

 

FA02AH11

 

525

 

BP875789

 

480

 

952

 

0

 

480

 

100

 

525

 

Os02g0181900|Os02g0181900 ClpB.

 

922

 

270

 

5.00E-73

 

161

 

81

 

525

 

ref|NP_565586.1| ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding / protein binding [Arabidopsis thaliana]

 

964

 

276

 

3.00E-73

 

161

 

85

 

525

 

SGN-U347119

 

1143

 

967

 

0

 

488

 

100

 

525

 

Q8YM56|CLPB2_ANASP Chaperone clpB 2 - Anabaena sp. (strain PCC 7120)

 

872

 

240

 

2.00E-63

 

161

 

72

 

525

 

AT2G25140.1 | Symbol: None | heat shock protein 100, putative / HSP100, putative / heat shock protein clpB, putative / HSP100/ClpB, putative, similar to HSP100/ClpB GI:9651530 (Phaseolus lunatus) | chr2:10704782-10709231 REVERSE | Aliases: F13D4.100, F13D4_100

 

964

 

276

 

5.00E-75

 

161

 

85

 

CGTTCAAGTATGGGACCCTAATTACCCTTCAACGCCAGCTAGAAGAAGCAGAGAGAAACCTGGCTGACTACCAGAAGTCTGGGAGTTCAATGCTTCGCGAAGAAGTAACAGATCTTGATATTATTGAAATTGTAAGCAAGTGGACGGGCATACCATTATCAAACCTTCAGCAGTCTGAGAGAGACAAGCTTGTCTTTTTAGAAAATGAACTTCACAAAAGAGTTATTGGTCAGGATATGGCAGTAAAATCTGTAGCTGATTCAATCAGGCGATCCAGGGCAGGCCTATCCGATCCAAATCGGCCCATTGCAAGCTTTATGTTTATGGGCCCTACAGGAGTTGGCAAAACTGAACTTGGAAAGGCTCTTGCTGCTTACCTTTTCAATACTGAAAACGCTTTGGTGCGTATTGACATGAGTGAATACATGGAGAAACATGCTGTTTCACGGTTGGTTGGTGCACCACCAGGTTATGTTGGATATGAAGAG

 

488

 

19