Contig9478

Contig9478

 

sgn|E320659/LEFL2045N17

 

677

 

AA824665 similar to GP|20197166|gb|AAC27402.2 expressed protein {Arabidopsis thaliana}, partial (37%)

 

560

 

377

 

1.00E-104

 

193

 

99

 

677

 

AK119617|Os07g0660700 WD40-like domain containing protein.

 

353

 

272

 

1.00E-73

 

208

 

59

 

677

 

ref|NP_565782.1| nucleotide binding [Arabidopsis thaliana]

 

353

 

304

 

2.00E-81

 

214

 

67

 

677

 

SGN-U343186

 

1031

 

462

 

1.00E-129

 

329

 

93

 

677

 

Q58DT8|WDR55_BOVIN WD repeat protein 55 - Bos taurus (Bovine)

 

382

 

137

 

5.00E-32

 

202

 

35

 

677

 

AT2G34260.1 | Symbol: None | transducin family protein / WD-40 repeat family protein, similar to Vegetatible incompatibility protein HET-E-1 (SP:Q00808) {Podospora anserina} | chr2:14472928-14475604 FORWARD | Aliases: F13P17.10, F13P17_10

 

353

 

304

 

3.00E-83

 

214

 

67

 

AAGCCTAAACCCTTGTCAGGGAAGTATGGCTGCCGTGGAGATAGACCTTGGAAAGCTTCCATTTGACATTGATTTTCATCCCTCCGATCACCTTGTTGCTGCTGGACTCATCACCGGCGACCTTCTCTTGTACCGTTACAATGCTGATTCTCCGGCTCAGAAGTTGTTGGAAGTAAAAGCTCATAGTGAATCATGTAGAACTGTCCGGATTATCAACGAGGGCCGTGCAATTGTGACGGGATCTCCAGATTGTTCTATTCTTGCAACAGACATTGAGACTGGCTCAGAAATTGTTCGCCTGGAGAATTCCCATGGGGCTGCTGTTAATCGAATTGTTAATTTGACTGAGTCAAGTATTGCTTCCGGAGACGATGAAGGATGCATTAAGGTATGGGATACCAGACAACGCTCATGCTCCCATTCTTTTAATGCACATGAAGAATACATTTCAGACATTACATTTGCAGCTGATTCCATGAAACTATTAGCAACAAGTGGCGATGGGTCACTTTCTGTATGCAATTTAAGGAGCAGTAAGATCCAAACTCGCTCTGAATTTTCTGAAGAGGAGCTGCTCTCTGTGGTAATTATGAAGAATGGTAGAAAAGTAATATGTGGTACTCAATCTGGAACTCTGTTACTGTATTCATGGGGATTTTTCAAGGATTGCAGTGATC

 

677

 

32162