Contig4

Contig4

 

FA01AD12/LA03CH09/sgn|E204664/LEFL2005N19/LEFL2039M11/sgn|E271847/LEFL1061BB05/LEFL1030AB01/LEFL2027E03/sgn|E371121/sgn|E270892/FA51AH10/FA19AD07/LEFL1025AA02/LEFL2023G02/LEFL1055BB04/sgn|E340033

 

915

 

TC188960 homologue to UP|Q9MAM6_ARATH (Q9MAM6) T25K16.8, partial (29%)

 

1144

 

1766

 

0

 

915

 

99

 

915

 

AK069299|Os04g0119400 Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1) (At1g01090/T25K16_8).

 

425

 

270

 

1.00E-72

 

182

 

73

 

915

 

gb|AAF26472.1|AC007323_13 T25K16.8 [Arabidopsis thaliana]

 

679

 

311

 

3.00E-83

 

218

 

72

 

915

 

SGN-U313753

 

1814

 

1507

 

0

 

820

 

98

 

915

 

Q1XDM0|ODPA_PORYE Pyruvate dehydrogenase E1 component subunit alpha (EC 1.2.4.1) - Porphyra yezoensis

 

346

 

234

 

3.00E-61

 

167

 

69

 

915

 

AT1G01090.1 | Symbol: None | pyruvate dehydrogenase E1 component alpha subunit, chloroplast, identical to pyruvate dehydrogenase E1 alpha subunit GB:AAB86803 GI:2454182 from (Arabidopsis thaliana): identical to cDNA pyruvate dehydrogenase E1 alpha subunit mRNA, nuclear gene encoding plastid protein GI:2454181 | chr1:47485-49279 REVERSE | Aliases: T25K16.8, T25K16_8

 

428

 

311

 

3.00E-85

 

218

 

72

 

GAGAGGGTGAGGCCTTAATAGTTCTATCAAATTATTAGTCCAACATCCCCATTTTGAGTTCTTTGACGTTAAATCCAACAATTTGCTTACATTTTCCCTTCTTGTTTTCTCCGCTCACTTCTTCCTTTATATATCACGCTTCATCTTCTGAACAATCCCATAAAATACATCAAGTTTTTCTCTGTAATCATGGCTGCATCAGCCTCTTCTTTTGCTGCTAACAATTTTTTGCAGCCTATCAACTCCACCAGATCCATTGACAACAACAACAAGAAGACCCTTTTGGGAAATCAGCTTAAAGACAGCTCCTTTTTTCTTGGATCAGCTAAGAAACTCTATATGAAGAAACCCTTTTCGTCTCAGAACTCGAAAAGCCGATCTAATGGTGTTTTCGCTGTTTCTGAGGTTGTTAAGAACAAGAAGCCCAATACAGACTCCTCACTCTCCAATCTGTTAATTACCAAGGATGAAGGGTTGGAGTTGTATGAAGATATGGTTCTTGGAAGAGCGTTTGAGGACATGTGTGCCCAAATGTATTACAGGGGAAAAATGTTTGGTTTTGTGCATTTGTACAACGGCCAAGAGGCAGTCTCTACTGGGTTCATTAAGCTACTGAAGAAGGAGGATTCTGTGGTTAGCACTTATCGTGATCACGTCCATGCATTGAGCAAAGGGGTTCCAGCACGTCAAGTGATGAGCGAGCTCTTTGGGAAGACCACTGGCTGTTGCAGAGGCCAGGGTGGCTCCATGCACATGTTCTCTAAAGAGCACAACGTTCTTGGTGGTTTCGCTTTCATTGGTGAGGGTATCCCTGTGGCAACAGGTGCCGCCTTCACTAGCAAGTATAGAAGGGAGGTCATGAAAGAAGCAGATTGTGATCATGTAACTATGGCCTTCTTTGGTGATGGAACTTGC

 

915

 

22688