Contig23044

Contig23044

 

sgn|E365865/sgn|E372587

 

993

 

AW399754

 

442

 

823

 

0

 

423

 

99

 

993

 

AK105751|Os11g0637700 RNA-binding region RNP-1 (RNA recognition motif) domain containing protein.

 

467

 

61

 

1.00E-09

 

69

 

44

 

993

 

gb|AAK92717.1| putative RNA-binding protein [Arabidopsis thaliana]

 

494

 

66

 

2.00E-09

 

90

 

43

 

993

 

SGN-U332130

 

993

 

1901

 

0

 

983

 

99

 

993

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

993

 

AT3G07810.1 | Symbol: None | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) | chr3:2492279-2495756 FORWARD | Aliases: F17A17.15

 

494

 

66

 

3.00E-11

 

90

 

43

 

CCTTTGCAGTAGCTGGAAATGGGAACACCGGGGCTGGAAACTTTAGCAACACTGGAGTTTGGGGTTCATCTTCAATTTCCCCTCAAGGTAGAGGAAATGTTTCTAACCAAAGTGGAAATCTTGGTTATGGGGGTGATGATAGTTTATATGGGTTGACTGGAGGCTATGGAAGAAATGTTACATCAAGTGGGGCTCCTACCTCATCATATCCTGCATCTAATGGTAGCTATGATGGGCCTTTAGCTGATTTTTACAGTGGTGGTTTGGGATATAGTGATTCCACTTGGCGCTCTGCAAATTCTGAGCGAGATGGATCTGGTTCAATTGGTTATGGACTCGGCAATGCACCCTCAGACATGCCACCTAAAAATTCTGCTAGTTATGTTGGCAGTTATGGTGTTGGTAAAAGACAGTCAAACAGCGGGATTGGTGGCTAGGAGCATATTGGCAAGCAAGGGTGTTACATTAGGTGAAACTTTGGTGTAGAATTTGAATCATGAATTTTGCGTACTTCTATAGCTATATGAAGTTGAGGTGTTAAAGAATTGGATATCCTTTTGTAGGGCTAACTGGAGTTGCTTGTTTTGAAGGTCTAGAGATAGAAGTTTACAAGATTTTGTGCTTAAGGGTTTTTTGTTTTGGGTTTATGTCTTTAGGAGTTCCCCCTTTTTGTTTTCCTTGAGTGAGGTGTAAAATCAGATTGCGGCATATAGTCAGAAATGTATCGTGCATCTCTGGTGAGGCAACGATACATACAAAAACAACATAGACAGAAAGTTTTGCGTAAAATCTTTAGAGTTAAATGTTTTTTGCTGTAACGTTGCAGATTCTCGTCTGGTAATGTGTTTGTTCTGTAGTTTCCCTTAAATGGGATTTTCCTTTTTTTTCATTTGGATGTAAGGGAGGTTGTTGATTTAGTGTGATACATTTTAGGGATACCCATCTAGGGTCTCCTAATGAATAATTTACTGCATATTGATGCTAAAAAAAAAA

 

993

 

45728