Contig23043

Contig23043

 

sgn|E365695/sgn|E319109/sgn|E238467/sgn|E313537/sgn|E313535/sgn|E367925

 

703

 

TC176690 similar to UP|Q9LDL7_ARATH (Q9LDL7) SCARECROW gene regulator-like (Phytochrome A signal transduction 1 protein), partial (32%)

 

587

 

1164

 

0

 

587

 

100

 

703

 

AY062210|Os07g0583600 Chitin-inducible gibberellin-responsive protein.

 

544

 

342

 

2.00E-94

 

232

 

70

 

703

 

gb|ABD72963.1| GRAS7 [Solanum lycopersicum]

 

366

 

466

 

1.00E-130

 

233

 

100

 

703

 

SGN-U323726

 

703

 

1394

 

0

 

703

 

100

 

703

 

Q8GVE1|CIGR2_ORYSA Chitin-inducible gibberellin-responsive protein 2 - Oryza sativa (Rice)

 

544

 

342

 

1.00E-93

 

232

 

70

 

703

 

AT5G48150.2 | Symbol: None | phytochrome A signal transduction 1 (PAT1) | chr5:19539485-19541834 REVERSE | Aliases: None

 

490

 

348

 

1.00E-96

 

233

 

73

 

GAGGTGCTTGTGCTAAAGCAATAGCGGAGAATAATTTGATCACAGCTGAATGGTTAATGTCAGAACTACGCACGGTGGTATCTGTTTGTGGGTCTCCCATACAACGTTTAGGTGCTTATATGCTGGAAGGTTTAGTTGCTAGATTGGCCTCCTCGGGAAGCTCCATCTACAAGGCCTTAAGGTGCAAAGAGCCTACTAGTGTCGAGCTATTCTCGTACATGCACTTGCTTTATGAAATCTGTCCATACTTCAAGTTTGGATATTTGTCAGCAAATGGTGCAATTGTTGATGCCATGAAAGATGAGAACTCAATTCATATAATCGATTTCCAGATTGCTCAGGGTAGCCAGTGGATCACCTTAATCCATGCTCTTGCAGCACGGCCTGGTGGACCTCCAAGAATCCGCATCACAGGGATTGATGACTCTACATCAGCTTACGCCAGAGGAGGAGGGATTGAAATCGTAGGTCGAAGACTGTCAAGCATTGCTGCATCTTGCAATGTACCTTTCGAATTTCATCCCGTGTCTGCTTCTTGTCCAGATATTGAGATTGAGCATCTTAAGGTTCTTCCCGGGGAACCATTGGCTGTTAACTTTGCGCTCGTCTTGCACCATATGCCTGATGAGAGCGTTGGAACTCAAAATCACAGAGACAGACTTCTGAGGATGGTTAAAAGCTTATCTCCCAAGATTGTTACCTT

 

703

 

45727