Contig23040

Contig23040

 

sgn|E365831/sgn|E336204/FA53DD06/sgn|E315104

 

743

 

TC178855 weakly similar to UP|Q9LU06_ARATH (Q9LU06) Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K15C23, partial (46%)

 

707

 

1390

 

0

 

705

 

99

 

743

 

AY346336|Os03g0126300 SAM (and some other nucleotide) binding motif domain containing protein.

 

346

 

227

 

6.00E-60

 

181

 

58

 

743

 

ref|NP_199273.1| unknown protein [Arabidopsis thaliana]

 

348

 

228

 

2.00E-58

 

201

 

58

 

743

 

SGN-U326220

 

743

 

1473

 

0

 

743

 

100

 

743

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

743

 

AT5G44600.1 | Symbol: None | expressed protein | chr5:18007094-18009253 FORWARD | Aliases: K15C23.4, K15C23_4

 

348

 

228

 

2.00E-60

 

201

 

58

 

TTATCCGCAAACTACACAGAAGGACATGAGCAGGCTTAGTGTATGGGGCGGCCCATCGGCGAGCGTATTTCCTATTGGCAATGAAAAGGTGTTGAGCTCCATTTCGCATTCGAGAAGACAAGTGCATTTGAGAAGAAGAAAGACGATAAGGAGCTGCGCAGCAGATTTCAAGGTGCTCACTTCTGTTACAAGTAATTATAATAGCATTGTAATCCTCGATACTCCACAATCACGAGTCCTGCTTCTCGATTCTTCCAATAATGTGCATAGCATCCTTCACAAGGAAACCAAATGGACGGGTGCATATTGGGACGAGTTTGCTGGCTTGCCGGCTATTGTTCCAAAGGGCCCTCTCGCAATCTTTGGCTTGGGGGGTGCAACTGCTGCACATTTGATGCTTGAACTGTGGCCTTCATTGCTGCTTGTTGGATGGGAGATAGATGAAATTTTGATTGCAAAAGCAAGAGAATATCTTGGGCTCTCTGATCTGGAGAAGCATACTCAAGGGGGAGGTGTGTTGGAAGTTCACATTGGAGATGTATTTTCTTCATCTGTTACTATTCCTGGAGGTTATGCAGGTATAATAGTTGATTTGTTTTCTGATGGAAAGGTTTTACCACAACTGGAAGAGGTTACAACTTGGTTGGAGATGAATAAGATGTTGATGCCCAATGGTCGGATCATGGTGAATTGTGGCGCTGCTACCAAAGATTGTCTGATAATTCTGAAATGATGCAACTGGA

 

743

 

45724