Contig23029

Contig23029

 

sgn|E367448/sgn|E367551

 

421

 

TC183650 similar to UP|Q5XWL3_SOLTU (Q5XWL3) Gag-pol polyprotein-like, partial (7%)

 

425

 

785

 

0

 

421

 

98

 

421

 

Os11g0524800|Os11g0524800 Integrase, catalytic region domain containing protein.

 

610

 

87

 

5.00E-18

 

133

 

33

 

421

 

gb|ABE88322.1| RNA-directed DNA polymerase (Reverse transcriptase): Peptidase aspartic, active site: Ribonuclease H: Retrotransposon gag protein: Retrovirus capsid, C-terminal [Medicago truncatula]

 

2347

 

184

 

1.00E-45

 

139

 

61

 

421

 

SGN-U332779

 

435

 

793

 

0

 

421

 

98

 

421

 

P03360|POL_AVIRE Pol polyprotein [Contains: Reverse transcriptase/ribonuclease H (EC 2.7.7.49) (EC 3.1.26.4) (RT): Integrase (IN)] (Fragment) - Avian reticuloendotheliosis virus

 

473

 

70

 

3.00E-12

 

107

 

35

 

421

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

GTCGCTTCTAATGGACACATATTTATTTTGGTTGCCATTGATTATTTCACCAAATGGGTGGAAGCATCTTTGTACAAGTCGGTAACCATGAAAGTTGTGATGGATTTTTTTCGCAACAACTTGATATGCAGATTTGGAGTACCAAAATGGATCAATACTGATAATGGGGCAAATATTAATAGTCACTTGATGAGAGATATATGTGAGCAATTTAAGGTCACTCATCGAAACTCAACCGCTTAGCGCCCTCAAATGAATAGAGCTGTAGAAGTCGCCAATAAGAATATCAAGAAGATGCTGAGAAAAATAATTGACAATCACCGAGGTTGACATGAGATGTTGCCATATGATTTATTGGGTTATCGGACGACTATCAAAATGTCGACTGGAGCTACTTTATACTTGCTAGTGTATGGGACAG

 

421

 

45713