Contig10003

Contig10003

 

sgn|E310340/sgn|E362356/LA22DH10/FA52DA03/LEFL1052BE08/LEFL1017CC04/LEFL1034AC12/LEFL2055E03/LEFL2045I16/LEFL2024D23/sgn|E364941/sgn|E365073/LEFL2017A22/LEFL1017CG12/LEFL2036L13/LEFL1095CE05/LEFL2009M02/LEFL2033K08/LEFL2034D13/LEFL1018CE08/sgn|E348983/LEFL1012DB09/sgn|E547675/sgn|E245443/sgn|E235904

 

930

 

TC187120 similar to GB|AAP31966.1|30387601|BT006622 At3g19640 {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (68%)

 

1598

 

1675

 

0

 

845

 

100

 

930

 

AK120875|Os01g0908500 Mg2+ transporter protein, CorA-like family protein.

 

444

 

234

 

6.00E-62

 

263

 

51

 

930

 

ref|NP_188598.2| metal ion transporter [Arabidopsis thaliana]

 

484

 

303

 

8.00E-81

 

278

 

61

 

930

 

SGN-U318444

 

848

 

1681

 

0

 

848

 

100

 

930

 

No hits found

 

0

 

0

 

-

 

0

 

0

 

930

 

AT3G19640.1 | Symbol: None | magnesium transporter CorA-like family protein (MRS2-3), low similarity to SP:Q01926 RNA splicing protein MRS2, mitochondrial precursor {Saccharomyces cerevisiae}: contains Pfam profile PF01544: CorA-like Mg2+ transporter protein | chr3:6820936-6823312 FORWARD | Aliases: MMB12.11

 

484

 

303

 

1.00E-82

 

278

 

61

 

AACCCATGAAATTTTGGGCGGGTTGGGAGCATAATTAGATACTCTCTGAGCCATTTGTTCACCGATTTAGCTTATCCCGGAGATTCTATTAAATTATGAGGGGCGTTACTCCGCCGCAGAAGTTTTCCGTTCCGTCGCCGGACGATGACGCCGATATAATCCGACCCAACACCGTCATCCCCGGCGGCGTAACCGTGGGCGCTGCTATGCGAAAGAAGGCCACCGGGGTACGTTCATGGCTTCTGTTGGATTCAACTGGACAGACCCAAGTTGTGGAAGCCGGGAAACATGCAATTATGCGGCGGACTGGACTTCCGGCTCGTGATCTTCGCATATTGGACCCACTTCTCTCGTATCCATCTACTGTGTTGGGTCGTGAACGGGCTATCGTCATCAATTTGGAGCATATCAAGGCTATTATTACCGCCCAGGAAGTCCTCTTGCTCAACGCTAGGGATCCCTCTGTTGCTCCTTTTGTTGAAGAGGTTCAACGGAGAATTTTGCGTCATCACCAAGCTACCAAGTCCCAGGAAGCTGGAGGGGGTGGCAATAATGCAGACTGGACAAATCTGTATGATCTGGAAGAGCCTCAGTCTGAAGAAGTTTCACCTCCGAACGTCTCTGCAAACTTCCAATCAATGGATGAGAACAAGTCTGATGGGAAGCAGCTAACGGGTGAGAATCGAGATGGGCCGAAGCTTCTCCCTTTTGAGTTTGTTGCTTTGGAGGCATGTCTGGAGGCTGCTTGCAGTTGCTTGGATAATGAGGCAAGGACACTGGAGCAAGAAGCTCATCCTGCTTTAGATAAGCTGACTTCAAAGATTAGTACTCTCAACTTGGAACGTGTTCGTCAAATCAAAAGTCGCTTGGTTGCTATTACAGGACGTGTTCAGAAGGTGAGAGATGAACTGGAGCATCTACTCGATGATG

 

930

 

32687