Contig10000

Contig10000

 

LEFL2055D13/sgn|E326967/sgn|E327779/sgn|E326230/sgn|E241084

 

1005

 

TC172129 weakly similar to RF|NP_850476.1|30690734|NM_180145 ATSWI3A: DNA binding {Arabidopsis thaliana} (exp=-1: wgp=0: cg=0), partial (26%)

 

989

 

1915

 

0

 

990

 

99

 

1005

 

AK102453|Os04g0480300 SWIRM domain containing protein.

 

560

 

206

 

2.00E-53

 

311

 

39

 

1005

 

ref|NP_850476.1| ATSWI3A: DNA binding [Arabidopsis thaliana]

 

512

 

278

 

2.00E-73

 

301

 

47

 

1005

 

SGN-U329228

 

727

 

1441

 

0

 

727

 

100

 

1005

 

O14470|YEPA_SCHPO Putative chromatin regulator protein C23H3.10 - Schizosaccharomyces pombe (Fission yeast)

 

503

 

143

 

9.00E-34

 

295

 

29

 

1005

 

AT2G47620.1 | Symbol: None | SWIRM domain-containing protein / DNA-binding family protein, contains similarity to SWI/SNF complex 170 KDa subunit (Homo sapiens) gi:1549241:gb:AAC50694: contains Pfam domains PF04433: SWIRM domain, PF00249: Myb-like DNA-binding domain | chr2:19539038-19541444 FORWARD | Aliases: T30B22.7

 

512

 

278

 

3.00E-75

 

301

 

47

 

GCACTTCTTCTCTATCGCCACTCAACAAATGCAGAAGAAGTTTTAACAATGGATGCATCTCGCTTGTATAAATCCTCCAACGAACTCGCTCACGACCTTTATACAATCCCTAGCTACACCAGTTGGTTTTCTTGGCAAAGCATACATGAGGTGGAAAGGTTGTCATTGCGAGAATTCTTCGATTGCAGTTCGATTACAAGGACACCCAGAATCTACAAAGAGTACAGGGACTACATCATTACCTCATACCGTCAGGATCCGACTCGAAGGCTTTCGTTTTCCGATATCCGGAAGTCGTTGGTGGGTGATATAAGTGTGCTACACAAGGTCTTTACCTTTTTGGAGAAGTGGGGTTTGATTAATTTTGACCCTAGTAATGCTGAAACGCCGGCTGCTATTCATGCTCCAGCGGAAGAGGATAAGGAGGATGAGAAGTGGAGGATTAGGGTTGAAGAAGGGACCCCACATGGGGTTAGGGTTGTGGCAGCTCCTCATTCTTTGAAACCCCTTGCACCGGTTCCGTCACCGGTTATCACAGGGCACAGAGGTGCTGGAAAGGGGAGGGGTGGTGGTACGGTGGATAATATACCAAAGTTTTCGCCTATGGCATCGTATCTAGATGTTTATGGGGAGTTGGTGGGGCAGCAGAAGGAGGAAAGTGTAGTCTGTCTGAGTTGTAAAGAACTGTGTGCTTCGGGTCATTATGAGTACAGCAAGGATGCGAGCTCGAATTTATGCGAGAAGTGTTTTACAAGTGGTAATTATGACAAAAACAAATTTGCAGATGAATTCAAGCCCATAGATGGTGCGAACCCTAAAGTCAACTGGACCGAAGCCGAAACTTTACTCCTATTAGAATCTGTACTGAAGCATGGTGATGACTGGGATCTTGTTACTCAAAATGTCAAAACGAAGAGTAAGCTGGATTGTATCTCCAAGCTTATACAGTTGCCATTTGGGGATCTTATGCTTGGTTCTATTCATAAAAAGTTTAATTTTTTGGAC

 

1005

 

32684