AT4G23710

AT4G23710

 

GO:0005575

 

(VACUOLAR ATP SYNTHASE SUBUNIT G 2, VACUOLAR ATP SYNTHASE SUBUNIT G2); unknown protein [EC:3.6.3.14] [SP:VATG2_ARATH Q0WT72_ARATH]

 

Primary Pumps (ATPases) Gene Families

 

V-Type ATPase

 

VHA-G2

 

Vag2

 

NULL

 

NULL

 

NULL

 

0

 

2

 

1

 

1

 

43

 

35

 

70

 

21

 

32

 

56

 

37

 

17

 

11

 

325

 

24

 

9

 

28

 

74

 

105

 

186

 

0

 

2

 

1

 

1

 

48

 

40

 

78

 

18

 

32

 

63

 

45

 

21

 

12

 

362

 

29

 

4

 

29

 

81

 

152

 

228

 

WT_D_27 vacuolar-type H+-ATPase (V-ATPase) subunit G2 (Vag2 / VHA-G2)

 

ATGGAATCTGCAGGGATCCAGCAACTGCTTGCTGCTGAACGTGAAGCTCAGCAAATTGTCAATGCCGCTAGGACCGCAAAAATGACTAGACTGAAGCAAGCCAAGGAAGAAGCTGAAACAGAGGTTGCTGAGCACAAAACCAGTACAGAGCAGGGGTTCCAGAGGAAACTCGAAGCGACAAGTGGAGATTCAGGTGCAAACGTGAAGAGGCTTGAGCAAGAGACTGATGCCAAAATCGAGCAATTGAAGAACGAAGCTACGAGAATTTCCAAAGATGTTGTGGATATGCTTCTGAAAAATGTGACCACAGTGAACAACTGA

 

1

 

68417.m03412 vacuolar ATP synthase subunit G 2 (VATG2) / V-ATPase G subunit 2 (VAG2) / vacuolar proton pump G subunit 2 identical to Swiss-Prot:O82629 vacuolar ATP synthase subunit G 2 (V-ATPase G subunit 2, Vacuolar proton pump G subunit 2) [Arabidopsis thaliana]

 

MESAGIQQLLAAEREAQQIVNAARTAKMTRLKQAKEEAETEVAEHKTSTEQGFQRKLEATSGDSGANVKRLEQETDAKIEQLKNEATRISKDVVDMLLKNVTTVNN*

 

19206