AT3G58730

AT3G58730

 

GO:0005774|GO:0005774|GO:0005774|GO:0015986|GO:0015986|GO:0015986|GO:0015986|GO:0046933|GO:0046961|GO:0046961

 

(VACUOLAR ATP SYNTHASE SUBUNIT D); hydrogen ion transporting ATP synthase, rotational mechanism / hydrogen ion transporting ATPase, rotational mechanism [EC:3.6.3.14] [SP:Q0WWD3_ARATH VATD_ARATH]

 

Primary Pumps (ATPases) Gene Families

 

V-Type ATPase

 

VHA-D

 

NULL

 

NULL

 

NULL

 

NULL

 

0

 

4

 

1

 

1

 

29

 

83

 

80

 

0

 

12

 

36

 

60

 

102

 

119

 

202

 

54

 

66

 

166

 

140

 

93

 

131

 

0

 

4

 

1

 

1

 

19

 

75

 

86

 

0

 

12

 

39

 

68

 

112

 

130

 

214

 

58

 

70

 

181

 

154

 

119

 

153

 

ve_c_26 vacuolar-type H+-ATPase (v-ATPase) subunit D (vATPD / VHA-D)

 

ATGGCTGGCCAAAACGCGCGTTTGAATGTGGTTCCCACTGTTACTATGCTCGGGGTTATGAAAGCTCGTCTTGTTGGCGCTACAAGAGGTCATGCTCTCCTCAAGAAAAAGAGTGATGCTTTAACTGTTCAGTTTAGGGCACTTCTCAAGAAAATCGTTACAGCTAAGGAGTCTATGGGAGATATGATGAAGACATCGTCTTTTGCTCTTACCGAAGTAAAGTATGTTGCTGGTGACAATGTCAAACATGTTGTCCTCGAGAACGTTAAAGAAGCTACTTTGAAGGTTCGTTCTCGGACAGAGAATATCGCTGGAGTGAAGCTGCCTAAGTTTGATCACTTCTCTGAAGGTGAGACCAAGAATGACTTGACCGGTTTAGCTAGAGGTGGTCAACAGGTCCGAGCTTGCCGTGTTGCTTATGTGAAAGCCATTGAAGTTCTAGTTGAGCTTGCTTCTCTCCAGACTTCTTTCTTGACCCTTGATGAAGCAATCAAGACGACTAACCGTAGGGTCAACGCTCTGGAGAATGTGGTGAAACCAAAGCTGGAGAATACAATCAGTTACATCAAGGGAGAGCTTGATGAGCTTGAGAGAGAGGATTTCTTCAGGTTGAAGAAGATTCAGGGATACAAGAGGAGGGAAGTCGAACGACAGGCAGCTAATGCTAAGGAGTTTGCTGAGGAAATGGTTCTTGAAGACATCTCTATGCAGAGAGGGATTTCGATAAACGCTGCTCGTAACTTCCTTGTTGGTGGTGCTGAGAAGGATTCAGACATTATTTTCTGA

 

1

 

68416.m06546 vacuolar ATP synthase subunit D (VATD) / V-ATPase D subunit / vacuolar proton pump D subunit (VATPD) identical to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit) (Swiss-Prot:Q9XGM1) [Arabidopsis thaliana]

 

MAGQNARLNVVPTVTMLGVMKARLVGATRGHALLKKKSDALTVQFRALLKKIVTAKESMGDMMKTSSFALTEVKYVAGDNVKHVVLENVKEATLKVRSRTENIAGVKLPKFDHFSEGETKNDLTGLARGGQQVRACRVAYVKAIEVLVELASLQTSFLTLDEAIKTTNRRVNALENVVKPKLENTISYIKGELDELEREDFFRLKKIQGYKRREVERQAANAKEFAEEMVLEDISMQRGISINAARNFLVGGAEKDSDIIF*

 

16331