AT1G76030

AT1G76030

 

GO:0005737|GO:0016469|GO:0046933|GO:0010255

 

(VACUOLAR ATP SYNTHASE SUBUNIT B1); hydrogen ion transporting ATP synthase, rotational mechanism [EC:3.6.3.14] [SP:VATB_ARATH]

 

Primary Pumps (ATPases) Gene Families

 

V-Type ATPase

 

VHA-B1

 

NULL

 

NULL

 

NULL

 

NULL

 

0

 

2

 

1

 

1

 

86

 

93

 

74

 

0

 

26

 

26

 

63

 

27

 

21

 

79

 

74

 

38

 

0

 

67

 

17

 

66

 

0

 

2

 

1

 

1

 

89

 

100

 

78

 

0

 

24

 

28

 

76

 

33

 

23

 

87

 

87

 

42

 

0

 

73

 

21

 

73

 

T4O12 vacuolar-type H+-ATPase subunit B1 (VHA-B1)

 

ATGGGGACGAATGATCTCGACATCGAAGAAGGGACTCTGGAGATCGGCATGGAGTATAGAACTGTTTCTGGTGTTGCTGGACCATTGGTCATTCTTGACAAAGTGAAGGGTCCAAAGTACCAGGAGATTGTTAATATTCGCTTAGGAGATGGATCAACGAGACGTGGTCAGGTTTTGGAAGTTGATGGCGAGAAAGCAGTTGTGCAGGTTTTTGAAGGAACATCTGGAATTGACAACAAGTTTACAACCGTGCAATTCACAGGAGAGGTTTTGAAAACACCTGTATCATTGGACATGCTTGGGCGCATATTTAACGGTTCAGGAAAGCCGATTGATAATGGCCCTCCTATTCTGCCAGAAGCATACCTTGATATTTCAGGAAGTTCAATCAACCCCAGTGAAAGAACCTATCCTGAAGAGATGATACAGACAGGCATATCGACCATCGATGTCATGAATTCCATTGCTCGTGGACAGAAGATTCCACTTTTCTCTGCTGCTGGTCTTCCACATAATGAAATAGCTGCTCAGATTTGTCGTCAGGCTGGTCTAGTCAAGCGTTTGGAAAAGACTGTTGATCTACTTGAGGATCATGGAGAGGACAATTTTGCAATTGTGTTTGCAGCTATGGGTGTGAACATGGAGACAGCTCAGTTCTTCAAGCGAGATTTTGAAGAAAATGGATCAATGGAGAGAGTTACTCTTTTCCTGAACCTGGCCAATGACCCAACCATTGAGAGAATCATCACTCCTCGAATTGCCCTCACAACAGCTGAATATCTGGCTTATGAATGTGGGAAACACGTCCTTGTTATATTGACGGATATGAGTTCTTATGCTGATGCTCTTCGTGAGGTTTCCGCTGCCCGAGAAGAGGTTCCCGGAAGACGTGGATATCCAGGTTATATGTACACTGATCTTGCAACTATTTATGAACGTGCTGGGCGTATAGAAGGAAGAAAAGGTTCCATCACCCAAATTCCAATCCTCACTATGCCCAATGACGATATCACTCATCCAACTCCGGATCTTACTGGTTACATTACTGAAGGTCAGATATATATCGATAGGCAACTTCACAACAGACAGATATATCCACCCATCAACGTGCTTCCATCCCTTTCTCGTTTAATGAAGAGTGCTATCGGCGAGGGCATGACTCGTAAAGACCATTCTGATGTGTCGAACCAGCTGTATGCAAATTATGCAATCGGGAAAGATGTTCAAGCGATGAAAGCTGTTGTTGGAGAAGAAGCACTTTCTTCAGAGGATTTGCTTTATCTAGAGTTTTTGGATAAGTTTGAGAGGAAGTTTGTGATGCAAGGAGCTTATGATACACGCAACATCTTCCAGTCGCTGGACTTAGCTTGGACATTGCTCCGTATCTTCCCACGGGAGCTTCTTCATCGTATCCCTGCAAAGACACTTGACCAATTCTACAGCCGCGACTCAACCAGTTAA

 

1

 

68414.m08827 vacuolar ATP synthase subunit B / V-ATPase B subunit / vacuolar proton pump B subunit / V-ATPase 57 kDa subunit identical to SP|P11574 Vacuolar ATP synthase subunit B (EC 3.6.3.14) (V-ATPase B subunit) (Vacuolar proton pump B subunit) (V-ATPase 57 kDa subunit) {Arabidopsis thaliana}

 

MGTNDLDIEEGTLEIGMEYRTVSGVAGPLVILDKVKGPKYQEIVNIRLGDGSTRRGQVLEVDGEKAVVQVFEGTSGIDNKFTTVQFTGEVLKTPVSLDMLGRIFNGSGKPIDNGPPILPEAYLDISGSSINPSERTYPEEMIQTGISTIDVMNSIARGQKIPLFSAAGLPHNEIAAQICRQAGLVKRLEKTVDLLEDHGEDNFAIVFAAMGVNMETAQFFKRDFEENGSMERVTLFLNLANDPTIERIITPRIALTTAEYLAYECGKHVLVILTDMSSYADALREVSAAREEVPGRRGYPGYMYTDLATIYERAGRIEGRKGSITQIPILTMPNDDITHPTPDLTGYITEGQIYIDRQLHNRQIYPPINVLPSLSRLMKSAIGEGMTRKDHSDVSNQLYANYAIGKDVQAMKAVVGEEALSSEDLLYLEFLDKFERKFVMQGAYDTRNIFQSLDLAWTLLRIFPRELLHRIPAKTLDQFYSRDSTS*

 

6638