AT1G12010

AT1G12010

 

GO:0005575|GO:0009815|GO:0008150

 

1-aminocyclopropane-1-carboxylate oxidase, putative / ACC oxidase, putative [EC:1.14.17.4] [SP:O65378_ARATH]

 

NULL

 

NULL

 

NULL

 

NULL

 

ethylene biosynthesis from methionine

 

1.14.17.4

 

1-aminocyclopropane-1-carboxylate oxidase

 

0

 

2

 

1

 

1

 

0

 

4

 

5

 

138

 

5

 

0

 

0

 

0

 

0

 

42

 

13

 

0

 

0

 

0

 

0

 

0

 

0

 

2

 

1

 

1

 

0

 

4

 

6

 

165

 

6

 

0

 

0

 

0

 

0

 

49

 

13

 

0

 

0

 

0

 

0

 

0

 

F12F1 putative amino-cyclopropane-carboxylic acid oxidase (ACC oxidase)

 

ATGGAGATGAACATTAAGTTTCCAGTTATAGACTTGTCTAAGCTCAATGGTGAAGAGAGAGACCAAACCATGGCTTTGATCGACGATGCTTGTCAAAACTGGGGCTTCTTCGAGCTGGTGAACCATGGACTACCATATGATCTAATGGACAACATTGAGAGGATGACAAAGGAACACTACAAGAAACATATGGAACAAAAGTTCAAAGAAATGCTTCGTTCCAAAGGTTTAGATACCCTCGAGACCGAAGTTGAAGATGTCGATTGGGAAAGCACTTTCTACCTCCATCATCTCCCTCAATCTAACCTATACGACATCCCTGATATGTCAAATGAATACCGATTGGCAATGAAGGATTTTGGGAAGAGGCTTGAGATTCTAGCTGAAGAGCTATTGGACTTGTTGTGTGAGAATCTAGGGTTGGAGAAAGGGTACTTGAAGAAGGTGTTTCATGGGACAACGGGTCCAACTTTTGCGACAAAGCTTAGCAACTATCCACCATGTCCTAAACCAGAGATGATCAAAGGGCTTAGGGCTCACACAGATGCAGGAGGCCTCATTTTGCTGTTTCAAGATGATAAGGTCAGTGGTCTCCAGCTTCTTAAAGATGGTGATTGGGTTGATGTTCCTCCTCTCAAGCATTCCATTGTCATCAACCTTGGTGACCAACTTGAGGTGATAACAAACGGGAAGTACAAGAGTGTAATGCACCGTGTGATGACCCAGAAAGAAGGAAACAGGATGTCTATCGCGTCGTTTTACAACCCCGGAAGCGATGCTGAGATCTCTCCGGCAACATCTCTTGTGGATAAAGACTCAAAATACCCAAGCTTTGTGTTTGATGACTACATGAAACTCTATGCCGGACTCAAGTTTCAGGCCAAGGAGCCACGGTTCGAGGCGATGAAAAATGCTGAAGCAGCTGCGGATTTGAATCCGGTGGCTGTGGTTGAGACATTCTAA

 

1

 

68414.m01387 1-aminocyclopropane-1-carboxylate oxidase, putative / ACC oxidase, putative Strong similarity to amino-cyclopropane-carboxylic acid oxidase (ACC ox2) [GI:559407] from Brassica napus. ESTs gb|Z48548 and gb|Z48549 come from this gene

 

MEMNIKFPVIDLSKLNGEERDQTMALIDDACQNWGFFELVNHGLPYDLMDNIERMTKEHYKKHMEQKFKEMLRSKGLDTLETEVEDVDWESTFYLHHLPQSNLYDIPDMSNEYRLAMKDFGKRLEILAEELLDLLCENLGLEKGYLKKVFHGTTGPTFATKLSNYPPCPKPEMIKGLRAHTDAGGLILLFQDDKVSGLQLLKDGDWVDVPPLKHSIVINLGDQLEVITNGKYKSVMHRVMTQKEGNRMSIASFYNPGSDAEISPATSLVDKDSKYPSFVFDDYMKLYAGLKFQAKEPRFEAMKNAEAAADLNPVAVVETF*

 

1216