SEQID Frame ORF Length TargetID Aln_Length E-value Score Accession

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

42

1E-15

83.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

42

 

0

 

0

 

761

 

802

 

96754

 

96795

 

1E-15

 

83.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

61

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96797

 

96758

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

62

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96758

 

96797

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

63

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96799

 

96760

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

64

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96760

 

96799

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

65

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96801

 

96762

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

66

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96762

 

96801

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

67

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96803

 

96764

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

68

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96764

 

96803

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

69

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96805

 

96766

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

70

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96766

 

96805

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

71

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96807

 

96768

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

72

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96768

 

96807

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

73

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96809

 

96770

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

74

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

40

2E-14

79.8

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

40

 

0

 

0

 

763

 

802

 

96770

 

96809

 

2E-14

 

79.8

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

75