SEQID Frame ORF Length TargetID Aln_Length E-value Score Accession

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

1397

0

1556.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

89.12

 

1397

 

151

 

1

 

6

 

1401

 

15800

 

14404

 

0

 

1556.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6736

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

1397

0

1556.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

89.12

 

1397

 

151

 

1

 

6

 

1401

 

15800

 

14404

 

0

 

1556.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6737

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

1397

0

1556.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

89.12

 

1397

 

151

 

1

 

6

 

1401

 

15800

 

14404

 

0

 

1556.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6738

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

1397

0

1556.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PFAMPF03732Retrotrans_gag
 7.7e-17 [1-90]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 3.2e-11 [1-71]T    
PANTHERPTHR10178:SF12POLYPROTEIN-RELATED
 3.2e-11 [1-71]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

89.12

 

1397

 

151

 

1

 

6

 

1401

 

15800

 

14404

 

0

 

1556.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6739

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

1397

0

1556.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PRINTSPR00939C2HCZNFINGER
 0.15 [94-103]T  0.15 [103-111]T   
PFAMPF00098zf-CCHC
 3.6e-05 [94-111]T    
SMARTSM00343no description
 0.0046 [95-111]T    
PROFILEPS50158ZF_CCHC
 10.477 [96-111]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsMolecular Function: nucleic acid binding (GO:0003676)
Molecular Function: zinc ion binding (GO:0008270)
noIPR
unintegrated
unintegrated
GENE3DG3D.4.10.60.10no description
 6.4e-05 [80-115]T    
SEGsegseg
 NA [120-152]?    
SUPERFAMILYSSF57756Retrovirus zinc finger-like domains
 1.4e-05 [84-120]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

89.12

 

1397

 

151

 

1

 

6

 

1401

 

15800

 

14404

 

0

 

1556.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6740

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

980

0

660.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

83.67

 

980

 

157

 

2

 

74

 

1052

 

21712

 

22689

 

0

 

660.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6741

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

980

0

660.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

83.67

 

980

 

157

 

2

 

74

 

1052

 

21712

 

22689

 

0

 

660.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6742

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

980

0

660.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

83.67

 

980

 

157

 

2

 

74

 

1052

 

21712

 

22689

 

0

 

660.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6743

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

980

0

660.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

83.67

 

980

 

157

 

2

 

74

 

1052

 

21712

 

22689

 

0

 

660.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6744

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

980

0

660.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PFAMPF03732Retrotrans_gag
 7.7e-17 [1-90]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 3.2e-11 [1-71]T    
PANTHERPTHR10178:SF12POLYPROTEIN-RELATED
 3.2e-11 [1-71]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

83.67

 

980

 

157

 

2

 

74

 

1052

 

21712

 

22689

 

0

 

660.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6745

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

980

0

660.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PRINTSPR00939C2HCZNFINGER
 0.15 [94-103]T  0.15 [103-111]T   
PFAMPF00098zf-CCHC
 3.6e-05 [94-111]T    
SMARTSM00343no description
 0.0046 [95-111]T    
PROFILEPS50158ZF_CCHC
 10.477 [96-111]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsMolecular Function: nucleic acid binding (GO:0003676)
Molecular Function: zinc ion binding (GO:0008270)
noIPR
unintegrated
unintegrated
GENE3DG3D.4.10.60.10no description
 6.4e-05 [80-115]T    
SEGsegseg
 NA [120-152]?    
SUPERFAMILYSSF57756Retrovirus zinc finger-like domains
 1.4e-05 [84-120]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

83.67

 

980

 

157

 

2

 

74

 

1052

 

21712

 

22689

 

0

 

660.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6746

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

346

6E-56

218.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

82.95

 

346

 

59

 

0

 

1060

 

1405

 

22733

 

23078

 

6E-56

 

218.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6747

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

346

6E-56

218.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

82.95

 

346

 

59

 

0

 

1060

 

1405

 

22733

 

23078

 

6E-56

 

218.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6748

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

346

6E-56

218.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

82.95

 

346

 

59

 

0

 

1060

 

1405

 

22733

 

23078

 

6E-56

 

218.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6749

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

346

6E-56

218.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

82.95

 

346

 

59

 

0

 

1060

 

1405

 

22733

 

23078

 

6E-56

 

218.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6750