SEQID Frame ORF Length TargetID Aln_Length E-value Score Accession

FC12BB11

2

ORF1

123

chr08_finished_C08HBa0022O08.1.v1.seq_C08HBa0022O08.1

710

0

1407.0

AK224749

Show
FC12BB11

FC12BB11

 

2

 

ORF1

 

754B6534B747B885

 

123

 

IPR012876

 

SEQUENCE: FC12BB11_2_ORF1CRC64: 754B6534B747B885LENGTH: 123 aa
InterPro
IPR012876
Family
Protein of unknown function DUF1677, plant
PF07911[12-122]T 1.3e-47 PF07911 DUF1677DUF1677

 

chr08_finished_C08HBa0022O08.1.v1.seq_C08HBa0022O08.1

 

100.0

 

710

 

0

 

0

 

1

 

710

 

11569

 

10860

 

0

 

1407.0

 

AK224749

 

gggtgtgaaatgtatatgatattcaaggtatttatcagcggtggagaaattgttgaagaagaaggcgagtgggataatatttcttttcgaagattgatttatatctattcaattaattgtagcatttgaaagaggtgagtggaatggaaagtgagatccaatttgtaaagtgcgcgtgttgtggattgacagaggaatgtacagagtcttacatagcgagagttcgggaccggaatgaagggcgatggatatgcggactgtgtgcagaggctgtgaaggatgaaatggtgagatccagaaggattggaagagatgaagctttgaatcgacacatgacattttgcaagaaattcagagcaaagagtttgcctcccaatccgacaggtgaattgatatcagcagtgaagcagttgctgctcaagaccttggattcgcctacatcaaatacggtgagtagacgagctttggtacgatcgcagagttgctttgaataatcggagtataataataataattgaagtaaatagcattcggtttgaataagtatttattgttatttagtgaaatttatgtatttgtattgaatcaattgtagtttggctaagatctactatttcattgcacatcaagctaagtatcaaggcaatggatatgaaaatgttactactacttttctgtaatcaatagtttcaagtgcttaatttaagcaaaaaaaaaa

 

46

 

FC15DG08

2

ORF2

207

chr08_finished_C08SLm0023K18.1.v1.seq_C08SLm0023K18.1

427

0

846.0

AK224786

Show
FC15DG08

FC15DG08

 

2

 

ORF2

 

E1C9A08C04794F5E

 

207

 

IPR003892 | IPR009060

 

SEQUENCE: FC15DG08_2_ORF2CRC64: E1C9A08C04794F5ELENGTH: 207 aa
InterPro
IPR003892
Domain
Ubiquitin system component Cue
PS51140[109-152]T 10.162 PS51140 CUECUE
InterPro
IPR009060
Domain
UBA-like
SSF46934[99-151]T 0.00011 SSF46934 UBA-likeUBA-like
noIPR
unintegrated
unintegrated
seg[196-207]? NA seg segseg

 

chr08_finished_C08SLm0023K18.1.v1.seq_C08SLm0023K18.1

 

100.0

 

427

 

0

 

0

 

106

 

532

 

55797

 

55371

 

0

 

846.0

 

AK224786

 

tttttctcagagagaaggagattcccttgtaatctttcatcgatctttcttcgttttctcggcgaaatttagggtttgaatctcgctgttcgatcgctattccgaagtgaactctatatgcacggcaccaatgaagacaggaacatcaactttgaacccctatgcagaagcatatgtgcctatttcgaaaagaggggcacctgacggaaacaaagaagctagatctccaaatgagttcaagagtggaagtgaggctgtttggttggcacctggtgtgacagctgtgcgaaatcaactgcagactccccaaattgctgatcagtataaactgaaagacttctcaacttatggctcgccatcacatagtccagtaggatctatgggtaaagaagttctgggtgaggaatctttcatggatttggcttatcttcagatgaattttcctggaatgtcagatgagtcactttctgaggtctatttagcaaacagttgtgacattgatgctgcggttgacatgctgaatcagcttgagctctactctggtgatgattttgaaaagcttccagacagccttgacattggtgatgtgtcagactcagggttctcaggcgataattcatctcagaaattgaagacagtgataggcgaaactgctacagttgcttcatcatctggtttatcagactcgcgttcaggcagttaaagatggttgtgctgaaggtgtttgttatggtcgtgtagatatggaaggtgtggatactaaaggatgtttttttttggttgaaattctccgtagatacaatacatacatctttccctatcattgtataggttggctccttatacttgtgtctttcagcagtgaattcaagctcgctcttcactagataaactagtgaacaatttttttcaaaaaaaaaa

 

47

 

FC15DG08

2

ORF2

207

chr08_finished_C08SLm0023K18.1.v1.seq_C08SLm0023K18.1

382

0

757.0

AK224786

Show
FC15DG08

FC15DG08

 

2

 

ORF2

 

E1C9A08C04794F5E

 

207

 

IPR003892 | IPR009060

 

SEQUENCE: FC15DG08_2_ORF2CRC64: E1C9A08C04794F5ELENGTH: 207 aa
InterPro
IPR003892
Domain
Ubiquitin system component Cue
PS51140[109-152]T 10.162 PS51140 CUECUE
InterPro
IPR009060
Domain
UBA-like
SSF46934[99-151]T 0.00011 SSF46934 UBA-likeUBA-like
noIPR
unintegrated
unintegrated
seg[196-207]? NA seg segseg

 

chr08_finished_C08SLm0023K18.1.v1.seq_C08SLm0023K18.1

 

100.0

 

382

 

0

 

0

 

531

 

912

 

53926

 

53545

 

0

 

757.0

 

AK224786

 

tttttctcagagagaaggagattcccttgtaatctttcatcgatctttcttcgttttctcggcgaaatttagggtttgaatctcgctgttcgatcgctattccgaagtgaactctatatgcacggcaccaatgaagacaggaacatcaactttgaacccctatgcagaagcatatgtgcctatttcgaaaagaggggcacctgacggaaacaaagaagctagatctccaaatgagttcaagagtggaagtgaggctgtttggttggcacctggtgtgacagctgtgcgaaatcaactgcagactccccaaattgctgatcagtataaactgaaagacttctcaacttatggctcgccatcacatagtccagtaggatctatgggtaaagaagttctgggtgaggaatctttcatggatttggcttatcttcagatgaattttcctggaatgtcagatgagtcactttctgaggtctatttagcaaacagttgtgacattgatgctgcggttgacatgctgaatcagcttgagctctactctggtgatgattttgaaaagcttccagacagccttgacattggtgatgtgtcagactcagggttctcaggcgataattcatctcagaaattgaagacagtgataggcgaaactgctacagttgcttcatcatctggtttatcagactcgcgttcaggcagttaaagatggttgtgctgaaggtgtttgttatggtcgtgtagatatggaaggtgtggatactaaaggatgtttttttttggttgaaattctccgtagatacaatacatacatctttccctatcattgtataggttggctccttatacttgtgtctttcagcagtgaattcaagctcgctcttcactagataaactagtgaacaatttttttcaaaaaaaaaa

 

48

 

FC15DG08

2

ORF2

207

chr08_finished_C08SLm0023K18.1.v1.seq_C08SLm0023K18.1

107

2E-54

212.0

AK224786

Show
FC15DG08

FC15DG08

 

2

 

ORF2

 

E1C9A08C04794F5E

 

207

 

IPR003892 | IPR009060

 

SEQUENCE: FC15DG08_2_ORF2CRC64: E1C9A08C04794F5ELENGTH: 207 aa
InterPro
IPR003892
Domain
Ubiquitin system component Cue
PS51140[109-152]T 10.162 PS51140 CUECUE
InterPro
IPR009060
Domain
UBA-like
SSF46934[99-151]T 0.00011 SSF46934 UBA-likeUBA-like
noIPR
unintegrated
unintegrated
seg[196-207]? NA seg segseg

 

chr08_finished_C08SLm0023K18.1.v1.seq_C08SLm0023K18.1

 

100.0

 

107

 

0

 

0

 

1

 

107

 

61303

 

61197

 

2E-54

 

212.0

 

AK224786

 

tttttctcagagagaaggagattcccttgtaatctttcatcgatctttcttcgttttctcggcgaaatttagggtttgaatctcgctgttcgatcgctattccgaagtgaactctatatgcacggcaccaatgaagacaggaacatcaactttgaacccctatgcagaagcatatgtgcctatttcgaaaagaggggcacctgacggaaacaaagaagctagatctccaaatgagttcaagagtggaagtgaggctgtttggttggcacctggtgtgacagctgtgcgaaatcaactgcagactccccaaattgctgatcagtataaactgaaagacttctcaacttatggctcgccatcacatagtccagtaggatctatgggtaaagaagttctgggtgaggaatctttcatggatttggcttatcttcagatgaattttcctggaatgtcagatgagtcactttctgaggtctatttagcaaacagttgtgacattgatgctgcggttgacatgctgaatcagcttgagctctactctggtgatgattttgaaaagcttccagacagccttgacattggtgatgtgtcagactcagggttctcaggcgataattcatctcagaaattgaagacagtgataggcgaaactgctacagttgcttcatcatctggtttatcagactcgcgttcaggcagttaaagatggttgtgctgaaggtgtttgttatggtcgtgtagatatggaaggtgtggatactaaaggatgtttttttttggttgaaattctccgtagatacaatacatacatctttccctatcattgtataggttggctccttatacttgtgtctttcagcagtgaattcaagctcgctcttcactagataaactagtgaacaatttttttcaaaaaaaaaa

 

49

 

FC15DH04

2

ORF2

99

chr02_finished_C02SLm0100O21.1.v1.seq_C02SLm0100O21.1

276

2E-49

194.0

AK224787

Show
FC15DH04

FC15DH04

 

2

 

ORF2

 

7086E94C62A4F5BA

 

99

 

IPR003313

 

SEQUENCE: FC15DH04_2_ORF2CRC64: 7086E94C62A4F5BALENGTH: 99 aa
InterPro
IPR003313
Domain
AraC protein, arabinose-binding/dimerisation
SSF51215[11-57]T 0.013 SSF51215 Regulatory protein AraCRegulatory protein AraC

 

chr02_finished_C02SLm0100O21.1.v1.seq_C02SLm0100O21.1

 

84.06

 

276

 

41

 

1

 

47

 

319

 

41146

 

41421

 

2E-49

 

194.0

 

AK224787

 

ttcttccgaatcgttttagcagaatcatctcaagagattgaagaagaagatgagtaagtatgtggagctgttggataccggagtgagaatggtggctagattcaattctcattgtcctcaaacttcccgtatgtactaccatcctcccgccaggcacgatgaagatcaccaccagattggagtctccggcggcgacggagggaagaaccaccagattggagtttccggcggtgaaaatgtgtccggtgtgagatttgggactgtggttgctaagatgggaactgatagcaatgatttcattctttttactctagtttaattaaccatagcactgttttttgaatgctcgatgaagatatttattatactcttgagaaatttaaaaaaaaaa

 

50

 

FC15DH04

2

ORF2

99

chr02_finished_C02HBa0212P19.1.v1.seq_C02HBa0212P19.1

276

2E-49

194.0

AK224787

Show
FC15DH04

FC15DH04

 

2

 

ORF2

 

7086E94C62A4F5BA

 

99

 

IPR003313

 

SEQUENCE: FC15DH04_2_ORF2CRC64: 7086E94C62A4F5BALENGTH: 99 aa
InterPro
IPR003313
Domain
AraC protein, arabinose-binding/dimerisation
SSF51215[11-57]T 0.013 SSF51215 Regulatory protein AraCRegulatory protein AraC

 

chr02_finished_C02HBa0212P19.1.v1.seq_C02HBa0212P19.1

 

84.06

 

276

 

41

 

1

 

47

 

319

 

21788

 

22063

 

2E-49

 

194.0

 

AK224787

 

ttcttccgaatcgttttagcagaatcatctcaagagattgaagaagaagatgagtaagtatgtggagctgttggataccggagtgagaatggtggctagattcaattctcattgtcctcaaacttcccgtatgtactaccatcctcccgccaggcacgatgaagatcaccaccagattggagtctccggcggcgacggagggaagaaccaccagattggagtttccggcggtgaaaatgtgtccggtgtgagatttgggactgtggttgctaagatgggaactgatagcaatgatttcattctttttactctagtttaattaaccatagcactgttttttgaatgctcgatgaagatatttattatactcttgagaaatttaaaaaaaaaa

 

51

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

254

1E-137

488.0

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

99.21

 

254

 

2

 

0

 

260

 

513

 

43157

 

42904

 

1E-137

 

488.0

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

52

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

95

2E-47

188.0

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

100.0

 

95

 

0

 

0

 

167

 

261

 

43334

 

43240

 

2E-47

 

188.0

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

53

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

86

4E-42

170.0

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

100.0

 

86

 

0

 

0

 

85

 

170

 

44446

 

44361

 

4E-42

 

170.0

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

54

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

95

4E-33

141.0

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

93.68

 

95

 

6

 

0

 

167

 

261

 

49903

 

49809

 

4E-33

 

141.0

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

55

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

86

4E-30

131.0

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

94.19

 

86

 

5

 

0

 

85

 

170

 

53233

 

53148

 

4E-30

 

131.0

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

56

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

52

8E-22

103.0

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

100.0

 

52

 

0

 

0

 

35

 

86

 

46627

 

46576

 

8E-22

 

103.0

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

57

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

40

1E-14

79.8

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

100.0

 

40

 

0

 

0

 

1

 

40

 

46902

 

46863

 

1E-14

 

79.8

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

58

 

FC16CH06

2

ORF2

80

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

67

5E-14

77.8

AK224797

Show
FC16CH06

FC16CH06

 

2

 

ORF2

 

FAB91CCAFCE39CE9

 

80

 

IPR003422

 

SEQUENCE: FC16CH06_2_ORF2CRC64: FAB91CCAFCE39CE9LENGTH: 80 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[11-80]T 7.4e-41 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[9-80]T 2.7e-09 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[18-80]T 1.6e-38 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[17-80]T 1.8e-24 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF5[9-80]T 2.7e-09 PTHR15336:SF5 gb def: CG30354-PAgb def: CG30354-PA
SSF81531[5-80]T 2.6e-24 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

91.04

 

67

 

5

 

1

 

372

 

438

 

49549

 

49484

 

5E-14

 

77.8

 

AK224797

 

ctcttcaccattcgcacctcattcagagaaaagtcaggtttttttgtagaatcaaagtcttcgtatccaatatctcgttgccatgtcggacgaggaagttgttgacccaaaggcgacaatggaagtatcttgcaagcctaagtgtgtaaggcaactaaaggattatcaggcatgtactagaaggatagaaggtgatgaatcagggagcaagcattgcactggacagtattttgattattggcaatgcattgacaaatgtgttgccccaaagctatttgaaaaactcaagtaacatggagataagtgttcatccattacgattttatcttgctttttcattgttgaagcctgtgctacagaattgcaatcccttcaatcaacttagttgccgcatggaaaattttgtactatgcacattattaagaagtgattaataaaggatacttatgggttaaattttgtggacacttttatttggtcagatgattcaaaatccggaggatattattcccaaaaaaaaaa

 

59

 

FC19AA10

1

ORF2

178

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

44

8E-17

87.7

AK224819

Show
FC19AA10

FC19AA10

 

1

 

ORF2

 

8152CF619768CF74

 

178

 

IPR000910 | IPR009071

 

SEQUENCE: FC19AA10_1_ORF2CRC64: 8152CF619768CF74LENGTH: 178 aa
InterPro
IPR000910
Domain
HMG1/2 (high mobility group) box
PF00505[55-124]T 1.4e-30 PF00505 HMG_boxHMG_box
SM00398[54-125]T 5.5e-25 SM00398 no descriptionno description
PS50118[55-124]T 18.927 PS50118 HMG_BOX_2HMG_BOX_2
InterPro
IPR009071
Domain
High mobility group box
SSF47095[53-132]T 8.7e-26 SSF47095 HMG-boxHMG-box
noIPR
unintegrated
unintegrated
coil[125-146]? NA coil coiled-coilcoiled-coil
G3D.1.10.30.10[53-132]T 2.2e-22 G3D.1.10.30.10 no descriptionno description
PTHR13711[51-132]T 5.8e-25 PTHR13711 SWI/SNF-RELATED CHROMATIN BINDING PROTEINSWI/SNF-RELATED CHROMATIN BINDING PROTEIN
seg[30-58]? NA seg seg[107-114]? NA seg seg[129-150]? NA seg seg[153-178]? NA seg segseg

 

chr08_finished_C08HBa0216M19.1.v2.seq_C08HBa0216M19.1

 

100.0

 

44

 

0

 

0

 

763

 

806

 

96795

 

96752

 

8E-17

 

87.7

 

AK224819

 

gctctgttttcttttcttcttcactttcggtgcttctgccaacaccttcttatcttcctcttctgttttaagtttcaatgaagggtggaaaaggaaaaggtgcattgagaaaagaaacaaggtcggcgttgaagcctgttgaggaccgaaagatggggaagagaaaagccacgttgaaggacgccaaaaagaaggtcacaaaggataaaaaggcaaagaaagatcccaataagcctaagaggcctcccagtgcctttttcgtattccttgaggaattcaggaagacatttaaaaaggagaatcctaatgtgaaggctgtttctgctgtcgggaaagctggaggagaaaagtggaaatctttgagtgcagctgaaaaatcaccatatgaagccaaagctgcaaaaaggaaggcagagtatggaaaactcatgaatgcttataacaataagcaggtggaaagctcagatgatgaggacgaagaagaaaaagaagaagaaaaagagaaaaggtcaaagcctgaggtacatgatgaagatgcggaggacagtggacagggcgaggaagaggacgatgaagacgaagaggatgaagatgaggaagatgattgaagctatgtaatttctggcttgcaccgtttccttggtccatcacatgcacacttcaaacataatagttttcgtaattctgttacctaaacctatgtattttctgttacctagttgagttttgcagtttgctgaaactcttaactcttgtgaactcatatatatatatatatatatatatatatatatatatatatgacgatatgtgatgtggcatctccccttgctttgattaaaaaaaaaa

 

60