SEQID Frame ORF Length TargetID Aln_Length E-value Score Accession

LEFL2029E19

3

ORF3

201

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

3475

0

6857.0

AK247841

Show
LEFL2029E19

LEFL2029E19

 

3

 

ORF3

 

4098E25163233341

 

201

 

IPR004044 | IPR009019

 

SEQUENCE: LEFL2029E19_3_ORF3CRC64: 4098E25163233341LENGTH: 201 aa
InterPro
IPR004044
Domain
KH, type 2
PFAMPF07650KH_2
 6.3e-06 [151-201]T    
PROFILEPS50823KH_TYPE_2
 11.228 [124-201]T    
Parentno parent
Childrenno children
Found inIPR005662IPR005703IPR005704IPR009019IPR010212
ContainsIPR004087
GO termsMolecular Function: nucleic acid binding (GO:0003676)
InterPro
IPR009019
Domain
KH, prokaryotic type
SUPERFAMILYSSF54814Prokaryotic type KH domain (KH-domain type II)
 6.3e-18 [101-201]T    
Parentno parent
Childrenno children
Found inIPR005662IPR005704IPR010212IPR010213
ContainsIPR004044IPR004087IPR008282
GO termsnone
noIPR
unintegrated
unintegrated
GENE3DG3D.3.30.300.20no description
 3.7e-24 [107-201]T    
GENE3DG3D.3.40.50.300no description
 6.6e-06 [34-102]T    
PANTHERPTHR11649MSS1/TRME-RELATED GTP-BINDING PROTEIN
 5.3e-91 [16-165]T    
PANTHERPTHR11649:SF6GTP-BINDING PROTEIN ERG
 5.3e-91 [16-165]T    
SEGsegseg
 NA [2-12]?  NA [43-61]?   
SUPERFAMILYSSF52540P-loop containing nucleoside triphosphate hydrolases
 1.3e-05 [12-99]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

 

99.91

 

3475

 

2

 

1

 

645

 

4119

 

60713

 

64186

 

0

 

6857.0

 

AK247841

 

cttctcaatagcagtataaagcaagtgcaaaagctgattctgggttcttaaaatctgcatgtttttcttgcatttggattttgcataagctcagagttgaaagatttgtgaaatcttgatatgaaagctttaagagttttgaggacattgaactcatcactatcttcaaatccaagcaaaacccatttcaattcaaccattttccttcgattttactcagcccaacctcaagaagaccaccccacaagcactggtgtttcttcctctgaagaagaggacacgtcttcctcagtcttcgacagttcgcaatacgatgtgggtgtgggattaaacaatgatgttaattcagaaagaagtgtaagctccacttgggacgagaaatatagggaaagagtgaaaactaaagtctttggtgaagacccttccgagattaagagttcaagaatcttgattaaagaagaggagaagagaagaagagctgctttattggctaggactcttctagaagctgcactggaccggcctgatgaggaaggggacgaagataaagaggatgagttggtgaaggaagaagatcaaatgtcattgagtgtgggaattattggagctcctaatgctgggaaatcttcattgactaattacatggttgggaccaaagtttctgctgtatcacggaagacaaataccactactcatgaagtcttaggtgtgatgactaaagggaaaacacaaattgtgagtgtactttgaattactaggtttcagttccattttccctgattgttgatctccatttcattttatcagctttttgttgcttgagctgcatctatttgcaaaaatgaattctaatctccaatatacaataaatacatatatttttcatggactttagtttcatgtatgatcactgaactttactcgctgtattggtaaagagttatgtaaaataattggattttgtccactacaatagtgaagtcccaaactatcttttctcacatcaaagtgattaaactatgtttgaatagctcagaaaatcattaaatatcctgctcaaattagacaacatgataaaacaacaaccaataacatactccttgtaatcgcacaagtggggtgttggagggtagagtgtaagcagaacaacccttgtagagatagagaagttgtttctgatagaccctcagcttagagcctgccaaacaaaaaatacaaatgacagaaaatgaaaaattcatcgtgtaaaggctttgactactcatgttttacaattaaacaaaaaagtaaaaaagattacttggcactgggaattttgaccatccagtcaattctattttttgagcaattcagacatagttcagtcaaaaaaagaaaatgaagaaaacagctttgtgattttactattcttttggataaagtgccgttacattgatgtgacaaaaatattgttttgcaacttaactggtatacagggtacccatacgtaaaactgacccactaaatggtcaaaaattagttttcttggacttagagtaagattacccaagcttgatgtcagccatcgttctttttgaaaagggggtatgtactcttacctgcagcatcttatcaactgattttttttttttcctttttgaagaacttttttttattttaagggaaaattttcacaaaagagaaaataagcaaatatatgactactagcaaaaatgccaaatcttatgagcttatcttgcaggttgaagtatactttttgggtctaaaatatatggagagcaaaagttctatatgtctaatgagttctttctgcagtgtttctttgacactcccgggcttatgctaaagaaaagtggatttccttacaaagacataaaagcacgtattgaaagtgcatggaggtctattgatctatatgatgtactcattgtcatatttgatgctcataggcatcttaccaagttagtttttcttcttgcttcaactccaaaagttcatatttatgcaataactatatgctcatctcatgatattatgtatgcaacattgttatctgtaattactagtaatatatgatttaataatagaagaaaaaatatcgtaggctaagatgtgttttgcttgtttaatctggatatgtttgtctaattttcagattttcatcgttaggcgagttcacagaagaacgtagatagtgttttccatagtagttctcttaccccaagcctgcatgcacttacttcctatatttttggactagatagctctctaattggtatactagcccatgtcatatggtaagatgtgctttgcttgtttaatctggatatgttttgtctatttcatagttaggcgagttcacagaagaaggtagatagtgtttccacagtactacccttacccccaagcctgcatgtacttatttgcctgtatttttggactagatacctctctgattcatacactagtcaatgtcaattttatatcagtgtttttattaagcataaatcaaacagtcctatgcatacttttgcattcaccatcattaacaaggtgcaaatcatattaacattttaaaggggaatcttagtagcttagttggttggttactcccaccttgttggtgagggttcgattccccacattgagatcccctcccctatttccccttcccctacctccaatttttcaaaaataattgagaaaatattaacatcttaaatgtgcatagctcaaaatttgcacataatataggtggagggaatagaatttctgaatgatgatacacatcctctatgacttactcaaatagatgggctttggcctgtccaattttcttgctctgtaaataagatatttattgcaaccacaacaaactcagtgtagaaggctgtataaatactttatagaggtaagattataggtccagaagagaagttcagcttgaaatatatcaatgatgtaacacctgtgttttgcacgtcgaggaaagaaaactacttactccatcacaatcttgtcattataggctttttggcggttagtggaccatttctaagtgaattttgtccctttgagctttttgacagtcaactgatcaaccttgaactgaaatttgacttggataaagctcttatatgccggttggggtttatttttttgaagattcatcttcagtatcaagataatatgtgaagtaatctcatggtccaattaatttcctgtcaaattcgacttctgggccaatttttaccaacggtttttggtttttgttcaagggtaagcttctttccctacacaaaaacatgattcagattgtgtgttaagccttgataaaaattttctcgctttgatagagtaggcttccacttggaatagaaatgtgaggaccttccaagatcattgttgagattggtttgtcatttgtgaggacttcctgagatgattatttacttgtagaatgtagaatatgtagcagctagagtaggtttcctttcttctttgtagtcatgtgatgtgctatctccaaatgtctgtcactagtttctcaaggtgggatgctatttatgtctatctaatccttccttttcttttatattagaaactttttttttaatttgcaaattccaatctagggttatgatttccgaacttcgtatatgtatatatgctagcaaagctccaaatattgagtttttggtgtgaacagttaagttctgtgtcctttgagccaaatgagaggctttggaatttattctccccccggcatcaccttaagtagctctgttcagtgaagataggtatcggtttccatgtttaaaatgaagtaaacttatcgagaaaaaagtattgtagagaggactggaggatgcacatataactgcatcttatagcaactaagtagattcatctgaattttgctggcattatttcttctgtctaattttttgatatataggcctgattctcgagtggtgaggttgattgagagaatgggctctgaggctaatccaaatcagaaacgcttactgtgcatcaataaagttgacctaatcgagaaaaagaaagacttgttgaaagttgttgaggaattcaaagaccttcctggatatgaaaggtgctttacggtatccggactaaagggcgctggagtgaaagatctaactaaatacttgatggagcagtcagtgaaaagaccgtgggatgaagatccatttgtcatgagtgaagaagttatgaagaatatttcaatggaggtagtcagggaaaagttgctacattacatacatcaggaaatcccatatggcattgaccatcgcctgatggactggaaggagttacgtgatggttccctgagaattgaacaccatttgatcacacacaagataagccaacgcaagattctcgtaggaaagaatggttccaaaatagggagaataggtatcgaggcaaatgaagagttgagaacgatattcaagagaaatgtccatctaatgcttatggttagagtgaaatcatgaagatgaaagacaatatccttgttttgcatgtgtgtatatatagatgtgctccagtttttgtcccttaccaaagcagttctcagttgacacaataatttaccaaagcattaatccaaaattatattgttatgatacaaaatatggaagagaagcttgatttccctttacatgtgaatacactcatattcttttccatagatttaaggtcaaaattctagacattgtttgtattcatgttgggatca

 

3947

 

LEFL2029E19

1

ORF2

212

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

3475

0

6857.0

AK247841

Show
LEFL2029E19

LEFL2029E19

 

1

 

ORF2

 

6F4FE3EC4A646C4E

 

212

 

IPR002917

 

SEQUENCE: LEFL2029E19_1_ORF2CRC64: 6F4FE3EC4A646C4ELENGTH: 212 aa
InterPro
IPR002917
Domain
GTP-binding protein, HSR1-related
PF01926[159-209]T 7.3e-11 PF01926 MMR_HSR1MMR_HSR1
noIPR
unintegrated
unintegrated
G3D.3.40.50.300[120-209]T 5.3e-14 G3D.3.40.50.300 no descriptionno description
PTHR11649[86-208]T 3.9e-40 PTHR11649 MSS1/TRME-RELATED GTP-BINDING PROTEINMSS1/TRME-RELATED GTP-BINDING PROTEIN
PTHR11649:SF6[86-208]T 3.9e-40 PTHR11649:SF6 GTP-BINDING PROTEIN ERGGTP-BINDING PROTEIN ERG
seg[45-69]? NA seg seg[111-135]? NA seg seg[139-155]? NA seg segseg
SSF52540[157-202]T 1.6e-06 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

 

99.91

 

3475

 

2

 

1

 

645

 

4119

 

60713

 

64186

 

0

 

6857.0

 

AK247841

 

cttctcaatagcagtataaagcaagtgcaaaagctgattctgggttcttaaaatctgcatgtttttcttgcatttggattttgcataagctcagagttgaaagatttgtgaaatcttgatatgaaagctttaagagttttgaggacattgaactcatcactatcttcaaatccaagcaaaacccatttcaattcaaccattttccttcgattttactcagcccaacctcaagaagaccaccccacaagcactggtgtttcttcctctgaagaagaggacacgtcttcctcagtcttcgacagttcgcaatacgatgtgggtgtgggattaaacaatgatgttaattcagaaagaagtgtaagctccacttgggacgagaaatatagggaaagagtgaaaactaaagtctttggtgaagacccttccgagattaagagttcaagaatcttgattaaagaagaggagaagagaagaagagctgctttattggctaggactcttctagaagctgcactggaccggcctgatgaggaaggggacgaagataaagaggatgagttggtgaaggaagaagatcaaatgtcattgagtgtgggaattattggagctcctaatgctgggaaatcttcattgactaattacatggttgggaccaaagtttctgctgtatcacggaagacaaataccactactcatgaagtcttaggtgtgatgactaaagggaaaacacaaattgtgagtgtactttgaattactaggtttcagttccattttccctgattgttgatctccatttcattttatcagctttttgttgcttgagctgcatctatttgcaaaaatgaattctaatctccaatatacaataaatacatatatttttcatggactttagtttcatgtatgatcactgaactttactcgctgtattggtaaagagttatgtaaaataattggattttgtccactacaatagtgaagtcccaaactatcttttctcacatcaaagtgattaaactatgtttgaatagctcagaaaatcattaaatatcctgctcaaattagacaacatgataaaacaacaaccaataacatactccttgtaatcgcacaagtggggtgttggagggtagagtgtaagcagaacaacccttgtagagatagagaagttgtttctgatagaccctcagcttagagcctgccaaacaaaaaatacaaatgacagaaaatgaaaaattcatcgtgtaaaggctttgactactcatgttttacaattaaacaaaaaagtaaaaaagattacttggcactgggaattttgaccatccagtcaattctattttttgagcaattcagacatagttcagtcaaaaaaagaaaatgaagaaaacagctttgtgattttactattcttttggataaagtgccgttacattgatgtgacaaaaatattgttttgcaacttaactggtatacagggtacccatacgtaaaactgacccactaaatggtcaaaaattagttttcttggacttagagtaagattacccaagcttgatgtcagccatcgttctttttgaaaagggggtatgtactcttacctgcagcatcttatcaactgattttttttttttcctttttgaagaacttttttttattttaagggaaaattttcacaaaagagaaaataagcaaatatatgactactagcaaaaatgccaaatcttatgagcttatcttgcaggttgaagtatactttttgggtctaaaatatatggagagcaaaagttctatatgtctaatgagttctttctgcagtgtttctttgacactcccgggcttatgctaaagaaaagtggatttccttacaaagacataaaagcacgtattgaaagtgcatggaggtctattgatctatatgatgtactcattgtcatatttgatgctcataggcatcttaccaagttagtttttcttcttgcttcaactccaaaagttcatatttatgcaataactatatgctcatctcatgatattatgtatgcaacattgttatctgtaattactagtaatatatgatttaataatagaagaaaaaatatcgtaggctaagatgtgttttgcttgtttaatctggatatgtttgtctaattttcagattttcatcgttaggcgagttcacagaagaacgtagatagtgttttccatagtagttctcttaccccaagcctgcatgcacttacttcctatatttttggactagatagctctctaattggtatactagcccatgtcatatggtaagatgtgctttgcttgtttaatctggatatgttttgtctatttcatagttaggcgagttcacagaagaaggtagatagtgtttccacagtactacccttacccccaagcctgcatgtacttatttgcctgtatttttggactagatacctctctgattcatacactagtcaatgtcaattttatatcagtgtttttattaagcataaatcaaacagtcctatgcatacttttgcattcaccatcattaacaaggtgcaaatcatattaacattttaaaggggaatcttagtagcttagttggttggttactcccaccttgttggtgagggttcgattccccacattgagatcccctcccctatttccccttcccctacctccaatttttcaaaaataattgagaaaatattaacatcttaaatgtgcatagctcaaaatttgcacataatataggtggagggaatagaatttctgaatgatgatacacatcctctatgacttactcaaatagatgggctttggcctgtccaattttcttgctctgtaaataagatatttattgcaaccacaacaaactcagtgtagaaggctgtataaatactttatagaggtaagattataggtccagaagagaagttcagcttgaaatatatcaatgatgtaacacctgtgttttgcacgtcgaggaaagaaaactacttactccatcacaatcttgtcattataggctttttggcggttagtggaccatttctaagtgaattttgtccctttgagctttttgacagtcaactgatcaaccttgaactgaaatttgacttggataaagctcttatatgccggttggggtttatttttttgaagattcatcttcagtatcaagataatatgtgaagtaatctcatggtccaattaatttcctgtcaaattcgacttctgggccaatttttaccaacggtttttggtttttgttcaagggtaagcttctttccctacacaaaaacatgattcagattgtgtgttaagccttgataaaaattttctcgctttgatagagtaggcttccacttggaatagaaatgtgaggaccttccaagatcattgttgagattggtttgtcatttgtgaggacttcctgagatgattatttacttgtagaatgtagaatatgtagcagctagagtaggtttcctttcttctttgtagtcatgtgatgtgctatctccaaatgtctgtcactagtttctcaaggtgggatgctatttatgtctatctaatccttccttttcttttatattagaaactttttttttaatttgcaaattccaatctagggttatgatttccgaacttcgtatatgtatatatgctagcaaagctccaaatattgagtttttggtgtgaacagttaagttctgtgtcctttgagccaaatgagaggctttggaatttattctccccccggcatcaccttaagtagctctgttcagtgaagataggtatcggtttccatgtttaaaatgaagtaaacttatcgagaaaaaagtattgtagagaggactggaggatgcacatataactgcatcttatagcaactaagtagattcatctgaattttgctggcattatttcttctgtctaattttttgatatataggcctgattctcgagtggtgaggttgattgagagaatgggctctgaggctaatccaaatcagaaacgcttactgtgcatcaataaagttgacctaatcgagaaaaagaaagacttgttgaaagttgttgaggaattcaaagaccttcctggatatgaaaggtgctttacggtatccggactaaagggcgctggagtgaaagatctaactaaatacttgatggagcagtcagtgaaaagaccgtgggatgaagatccatttgtcatgagtgaagaagttatgaagaatatttcaatggaggtagtcagggaaaagttgctacattacatacatcaggaaatcccatatggcattgaccatcgcctgatggactggaaggagttacgtgatggttccctgagaattgaacaccatttgatcacacacaagataagccaacgcaagattctcgtaggaaagaatggttccaaaatagggagaataggtatcgaggcaaatgaagagttgagaacgatattcaagagaaatgtccatctaatgcttatggttagagtgaaatcatgaagatgaaagacaatatccttgttttgcatgtgtgtatatatagatgtgctccagtttttgtcccttaccaaagcagttctcagttgacacaataatttaccaaagcattaatccaaaattatattgttatgatacaaaatatggaagagaagcttgatttccctttacatgtgaatacactcatattcttttccatagatttaaggtcaaaattctagacattgtttgtattcatgttgggatca

 

3944

 

LEFL2029E19

1

ORF2

212

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

3475

0

6857.0

AK247841

Show
LEFL2029E19

LEFL2029E19

 

1

 

ORF2

 

6F4FE3EC4A646C4E

 

212

 

IPR002917

 

SEQUENCE: LEFL2029E19_1_ORF2CRC64: 6F4FE3EC4A646C4ELENGTH: 212 aa
InterPro
IPR002917
Domain
GTP-binding protein, HSR1-related
PF01926[159-209]T 7.3e-11 PF01926 MMR_HSR1MMR_HSR1
noIPR
unintegrated
unintegrated
G3D.3.40.50.300[120-209]T 5.3e-14 G3D.3.40.50.300 no descriptionno description
PTHR11649[86-208]T 3.9e-40 PTHR11649 MSS1/TRME-RELATED GTP-BINDING PROTEINMSS1/TRME-RELATED GTP-BINDING PROTEIN
PTHR11649:SF6[86-208]T 3.9e-40 PTHR11649:SF6 GTP-BINDING PROTEIN ERGGTP-BINDING PROTEIN ERG
seg[45-69]? NA seg seg[111-135]? NA seg seg[139-155]? NA seg segseg
SSF52540[157-202]T 1.6e-06 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

 

99.91

 

3475

 

2

 

1

 

645

 

4119

 

60713

 

64186

 

0

 

6857.0

 

AK247841

 

cttctcaatagcagtataaagcaagtgcaaaagctgattctgggttcttaaaatctgcatgtttttcttgcatttggattttgcataagctcagagttgaaagatttgtgaaatcttgatatgaaagctttaagagttttgaggacattgaactcatcactatcttcaaatccaagcaaaacccatttcaattcaaccattttccttcgattttactcagcccaacctcaagaagaccaccccacaagcactggtgtttcttcctctgaagaagaggacacgtcttcctcagtcttcgacagttcgcaatacgatgtgggtgtgggattaaacaatgatgttaattcagaaagaagtgtaagctccacttgggacgagaaatatagggaaagagtgaaaactaaagtctttggtgaagacccttccgagattaagagttcaagaatcttgattaaagaagaggagaagagaagaagagctgctttattggctaggactcttctagaagctgcactggaccggcctgatgaggaaggggacgaagataaagaggatgagttggtgaaggaagaagatcaaatgtcattgagtgtgggaattattggagctcctaatgctgggaaatcttcattgactaattacatggttgggaccaaagtttctgctgtatcacggaagacaaataccactactcatgaagtcttaggtgtgatgactaaagggaaaacacaaattgtgagtgtactttgaattactaggtttcagttccattttccctgattgttgatctccatttcattttatcagctttttgttgcttgagctgcatctatttgcaaaaatgaattctaatctccaatatacaataaatacatatatttttcatggactttagtttcatgtatgatcactgaactttactcgctgtattggtaaagagttatgtaaaataattggattttgtccactacaatagtgaagtcccaaactatcttttctcacatcaaagtgattaaactatgtttgaatagctcagaaaatcattaaatatcctgctcaaattagacaacatgataaaacaacaaccaataacatactccttgtaatcgcacaagtggggtgttggagggtagagtgtaagcagaacaacccttgtagagatagagaagttgtttctgatagaccctcagcttagagcctgccaaacaaaaaatacaaatgacagaaaatgaaaaattcatcgtgtaaaggctttgactactcatgttttacaattaaacaaaaaagtaaaaaagattacttggcactgggaattttgaccatccagtcaattctattttttgagcaattcagacatagttcagtcaaaaaaagaaaatgaagaaaacagctttgtgattttactattcttttggataaagtgccgttacattgatgtgacaaaaatattgttttgcaacttaactggtatacagggtacccatacgtaaaactgacccactaaatggtcaaaaattagttttcttggacttagagtaagattacccaagcttgatgtcagccatcgttctttttgaaaagggggtatgtactcttacctgcagcatcttatcaactgattttttttttttcctttttgaagaacttttttttattttaagggaaaattttcacaaaagagaaaataagcaaatatatgactactagcaaaaatgccaaatcttatgagcttatcttgcaggttgaagtatactttttgggtctaaaatatatggagagcaaaagttctatatgtctaatgagttctttctgcagtgtttctttgacactcccgggcttatgctaaagaaaagtggatttccttacaaagacataaaagcacgtattgaaagtgcatggaggtctattgatctatatgatgtactcattgtcatatttgatgctcataggcatcttaccaagttagtttttcttcttgcttcaactccaaaagttcatatttatgcaataactatatgctcatctcatgatattatgtatgcaacattgttatctgtaattactagtaatatatgatttaataatagaagaaaaaatatcgtaggctaagatgtgttttgcttgtttaatctggatatgtttgtctaattttcagattttcatcgttaggcgagttcacagaagaacgtagatagtgttttccatagtagttctcttaccccaagcctgcatgcacttacttcctatatttttggactagatagctctctaattggtatactagcccatgtcatatggtaagatgtgctttgcttgtttaatctggatatgttttgtctatttcatagttaggcgagttcacagaagaaggtagatagtgtttccacagtactacccttacccccaagcctgcatgtacttatttgcctgtatttttggactagatacctctctgattcatacactagtcaatgtcaattttatatcagtgtttttattaagcataaatcaaacagtcctatgcatacttttgcattcaccatcattaacaaggtgcaaatcatattaacattttaaaggggaatcttagtagcttagttggttggttactcccaccttgttggtgagggttcgattccccacattgagatcccctcccctatttccccttcccctacctccaatttttcaaaaataattgagaaaatattaacatcttaaatgtgcatagctcaaaatttgcacataatataggtggagggaatagaatttctgaatgatgatacacatcctctatgacttactcaaatagatgggctttggcctgtccaattttcttgctctgtaaataagatatttattgcaaccacaacaaactcagtgtagaaggctgtataaatactttatagaggtaagattataggtccagaagagaagttcagcttgaaatatatcaatgatgtaacacctgtgttttgcacgtcgaggaaagaaaactacttactccatcacaatcttgtcattataggctttttggcggttagtggaccatttctaagtgaattttgtccctttgagctttttgacagtcaactgatcaaccttgaactgaaatttgacttggataaagctcttatatgccggttggggtttatttttttgaagattcatcttcagtatcaagataatatgtgaagtaatctcatggtccaattaatttcctgtcaaattcgacttctgggccaatttttaccaacggtttttggtttttgttcaagggtaagcttctttccctacacaaaaacatgattcagattgtgtgttaagccttgataaaaattttctcgctttgatagagtaggcttccacttggaatagaaatgtgaggaccttccaagatcattgttgagattggtttgtcatttgtgaggacttcctgagatgattatttacttgtagaatgtagaatatgtagcagctagagtaggtttcctttcttctttgtagtcatgtgatgtgctatctccaaatgtctgtcactagtttctcaaggtgggatgctatttatgtctatctaatccttccttttcttttatattagaaactttttttttaatttgcaaattccaatctagggttatgatttccgaacttcgtatatgtatatatgctagcaaagctccaaatattgagtttttggtgtgaacagttaagttctgtgtcctttgagccaaatgagaggctttggaatttattctccccccggcatcaccttaagtagctctgttcagtgaagataggtatcggtttccatgtttaaaatgaagtaaacttatcgagaaaaaagtattgtagagaggactggaggatgcacatataactgcatcttatagcaactaagtagattcatctgaattttgctggcattatttcttctgtctaattttttgatatataggcctgattctcgagtggtgaggttgattgagagaatgggctctgaggctaatccaaatcagaaacgcttactgtgcatcaataaagttgacctaatcgagaaaaagaaagacttgttgaaagttgttgaggaattcaaagaccttcctggatatgaaaggtgctttacggtatccggactaaagggcgctggagtgaaagatctaactaaatacttgatggagcagtcagtgaaaagaccgtgggatgaagatccatttgtcatgagtgaagaagttatgaagaatatttcaatggaggtagtcagggaaaagttgctacattacatacatcaggaaatcccatatggcattgaccatcgcctgatggactggaaggagttacgtgatggttccctgagaattgaacaccatttgatcacacacaagataagccaacgcaagattctcgtaggaaagaatggttccaaaatagggagaataggtatcgaggcaaatgaagagttgagaacgatattcaagagaaatgtccatctaatgcttatggttagagtgaaatcatgaagatgaaagacaatatccttgttttgcatgtgtgtatatatagatgtgctccagtttttgtcccttaccaaagcagttctcagttgacacaataatttaccaaagcattaatccaaaattatattgttatgatacaaaatatggaagagaagcttgatttccctttacatgtgaatacactcatattcttttccatagatttaaggtcaaaattctagacattgtttgtattcatgttgggatca

 

3942

 

LEFL2029E19

3

ORF3

201

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

3475

0

6857.0

AK247841

Show
LEFL2029E19

LEFL2029E19

 

3

 

ORF3

 

4098E25163233341

 

201

 

IPR004044 | IPR009019

 

SEQUENCE: LEFL2029E19_3_ORF3CRC64: 4098E25163233341LENGTH: 201 aa
InterPro
IPR004044
Domain
KH, type 2
PF07650[151-201]T 6.3e-06 PF07650 KH_2KH_2
PS50823[124-201]T 11.228 PS50823 KH_TYPE_2KH_TYPE_2
InterPro
IPR009019
Domain
KH, prokaryotic type
SSF54814[101-201]T 6.3e-18 SSF54814 Prokaryotic type KH domain (KH-domain type II)Prokaryotic type KH domain (KH-domain type II)
noIPR
unintegrated
unintegrated
G3D.3.30.300.20[107-201]T 3.7e-24 G3D.3.30.300.20 no descriptionno description
G3D.3.40.50.300[34-102]T 6.6e-06 G3D.3.40.50.300 no descriptionno description
PTHR11649[16-165]T 5.3e-91 PTHR11649 MSS1/TRME-RELATED GTP-BINDING PROTEINMSS1/TRME-RELATED GTP-BINDING PROTEIN
PTHR11649:SF6[16-165]T 5.3e-91 PTHR11649:SF6 GTP-BINDING PROTEIN ERGGTP-BINDING PROTEIN ERG
seg[2-12]? NA seg seg[43-61]? NA seg segseg
SSF52540[12-99]T 1.3e-05 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

 

99.91

 

3475

 

2

 

1

 

645

 

4119

 

60713

 

64186

 

0

 

6857.0

 

AK247841

 

cttctcaatagcagtataaagcaagtgcaaaagctgattctgggttcttaaaatctgcatgtttttcttgcatttggattttgcataagctcagagttgaaagatttgtgaaatcttgatatgaaagctttaagagttttgaggacattgaactcatcactatcttcaaatccaagcaaaacccatttcaattcaaccattttccttcgattttactcagcccaacctcaagaagaccaccccacaagcactggtgtttcttcctctgaagaagaggacacgtcttcctcagtcttcgacagttcgcaatacgatgtgggtgtgggattaaacaatgatgttaattcagaaagaagtgtaagctccacttgggacgagaaatatagggaaagagtgaaaactaaagtctttggtgaagacccttccgagattaagagttcaagaatcttgattaaagaagaggagaagagaagaagagctgctttattggctaggactcttctagaagctgcactggaccggcctgatgaggaaggggacgaagataaagaggatgagttggtgaaggaagaagatcaaatgtcattgagtgtgggaattattggagctcctaatgctgggaaatcttcattgactaattacatggttgggaccaaagtttctgctgtatcacggaagacaaataccactactcatgaagtcttaggtgtgatgactaaagggaaaacacaaattgtgagtgtactttgaattactaggtttcagttccattttccctgattgttgatctccatttcattttatcagctttttgttgcttgagctgcatctatttgcaaaaatgaattctaatctccaatatacaataaatacatatatttttcatggactttagtttcatgtatgatcactgaactttactcgctgtattggtaaagagttatgtaaaataattggattttgtccactacaatagtgaagtcccaaactatcttttctcacatcaaagtgattaaactatgtttgaatagctcagaaaatcattaaatatcctgctcaaattagacaacatgataaaacaacaaccaataacatactccttgtaatcgcacaagtggggtgttggagggtagagtgtaagcagaacaacccttgtagagatagagaagttgtttctgatagaccctcagcttagagcctgccaaacaaaaaatacaaatgacagaaaatgaaaaattcatcgtgtaaaggctttgactactcatgttttacaattaaacaaaaaagtaaaaaagattacttggcactgggaattttgaccatccagtcaattctattttttgagcaattcagacatagttcagtcaaaaaaagaaaatgaagaaaacagctttgtgattttactattcttttggataaagtgccgttacattgatgtgacaaaaatattgttttgcaacttaactggtatacagggtacccatacgtaaaactgacccactaaatggtcaaaaattagttttcttggacttagagtaagattacccaagcttgatgtcagccatcgttctttttgaaaagggggtatgtactcttacctgcagcatcttatcaactgattttttttttttcctttttgaagaacttttttttattttaagggaaaattttcacaaaagagaaaataagcaaatatatgactactagcaaaaatgccaaatcttatgagcttatcttgcaggttgaagtatactttttgggtctaaaatatatggagagcaaaagttctatatgtctaatgagttctttctgcagtgtttctttgacactcccgggcttatgctaaagaaaagtggatttccttacaaagacataaaagcacgtattgaaagtgcatggaggtctattgatctatatgatgtactcattgtcatatttgatgctcataggcatcttaccaagttagtttttcttcttgcttcaactccaaaagttcatatttatgcaataactatatgctcatctcatgatattatgtatgcaacattgttatctgtaattactagtaatatatgatttaataatagaagaaaaaatatcgtaggctaagatgtgttttgcttgtttaatctggatatgtttgtctaattttcagattttcatcgttaggcgagttcacagaagaacgtagatagtgttttccatagtagttctcttaccccaagcctgcatgcacttacttcctatatttttggactagatagctctctaattggtatactagcccatgtcatatggtaagatgtgctttgcttgtttaatctggatatgttttgtctatttcatagttaggcgagttcacagaagaaggtagatagtgtttccacagtactacccttacccccaagcctgcatgtacttatttgcctgtatttttggactagatacctctctgattcatacactagtcaatgtcaattttatatcagtgtttttattaagcataaatcaaacagtcctatgcatacttttgcattcaccatcattaacaaggtgcaaatcatattaacattttaaaggggaatcttagtagcttagttggttggttactcccaccttgttggtgagggttcgattccccacattgagatcccctcccctatttccccttcccctacctccaatttttcaaaaataattgagaaaatattaacatcttaaatgtgcatagctcaaaatttgcacataatataggtggagggaatagaatttctgaatgatgatacacatcctctatgacttactcaaatagatgggctttggcctgtccaattttcttgctctgtaaataagatatttattgcaaccacaacaaactcagtgtagaaggctgtataaatactttatagaggtaagattataggtccagaagagaagttcagcttgaaatatatcaatgatgtaacacctgtgttttgcacgtcgaggaaagaaaactacttactccatcacaatcttgtcattataggctttttggcggttagtggaccatttctaagtgaattttgtccctttgagctttttgacagtcaactgatcaaccttgaactgaaatttgacttggataaagctcttatatgccggttggggtttatttttttgaagattcatcttcagtatcaagataatatgtgaagtaatctcatggtccaattaatttcctgtcaaattcgacttctgggccaatttttaccaacggtttttggtttttgttcaagggtaagcttctttccctacacaaaaacatgattcagattgtgtgttaagccttgataaaaattttctcgctttgatagagtaggcttccacttggaatagaaatgtgaggaccttccaagatcattgttgagattggtttgtcatttgtgaggacttcctgagatgattatttacttgtagaatgtagaatatgtagcagctagagtaggtttcctttcttctttgtagtcatgtgatgtgctatctccaaatgtctgtcactagtttctcaaggtgggatgctatttatgtctatctaatccttccttttcttttatattagaaactttttttttaatttgcaaattccaatctagggttatgatttccgaacttcgtatatgtatatatgctagcaaagctccaaatattgagtttttggtgtgaacagttaagttctgtgtcctttgagccaaatgagaggctttggaatttattctccccccggcatcaccttaagtagctctgttcagtgaagataggtatcggtttccatgtttaaaatgaagtaaacttatcgagaaaaaagtattgtagagaggactggaggatgcacatataactgcatcttatagcaactaagtagattcatctgaattttgctggcattatttcttctgtctaattttttgatatataggcctgattctcgagtggtgaggttgattgagagaatgggctctgaggctaatccaaatcagaaacgcttactgtgcatcaataaagttgacctaatcgagaaaaagaaagacttgttgaaagttgttgaggaattcaaagaccttcctggatatgaaaggtgctttacggtatccggactaaagggcgctggagtgaaagatctaactaaatacttgatggagcagtcagtgaaaagaccgtgggatgaagatccatttgtcatgagtgaagaagttatgaagaatatttcaatggaggtagtcagggaaaagttgctacattacatacatcaggaaatcccatatggcattgaccatcgcctgatggactggaaggagttacgtgatggttccctgagaattgaacaccatttgatcacacacaagataagccaacgcaagattctcgtaggaaagaatggttccaaaatagggagaataggtatcgaggcaaatgaagagttgagaacgatattcaagagaaatgtccatctaatgcttatggttagagtgaaatcatgaagatgaaagacaatatccttgttttgcatgtgtgtatatatagatgtgctccagtttttgtcccttaccaaagcagttctcagttgacacaataatttaccaaagcattaatccaaaattatattgttatgatacaaaatatggaagagaagcttgatttccctttacatgtgaatacactcatattcttttccatagatttaaggtcaaaattctagacattgtttgtattcatgttgggatca

 

3943

 

LEFL2029E19

3

ORF3

201

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

3475

0

6857.0

AK247841

Show
LEFL2029E19

LEFL2029E19

 

3

 

ORF3

 

4098E25163233341

 

201

 

IPR004044 | IPR009019

 

SEQUENCE: LEFL2029E19_3_ORF3CRC64: 4098E25163233341LENGTH: 201 aa
InterPro
IPR004044
Domain
KH, type 2
PF07650[151-201]T 6.3e-06 PF07650 KH_2KH_2
PS50823[124-201]T 11.228 PS50823 KH_TYPE_2KH_TYPE_2
InterPro
IPR009019
Domain
KH, prokaryotic type
SSF54814[101-201]T 6.3e-18 SSF54814 Prokaryotic type KH domain (KH-domain type II)Prokaryotic type KH domain (KH-domain type II)
noIPR
unintegrated
unintegrated
G3D.3.30.300.20[107-201]T 3.7e-24 G3D.3.30.300.20 no descriptionno description
G3D.3.40.50.300[34-102]T 6.6e-06 G3D.3.40.50.300 no descriptionno description
PTHR11649[16-165]T 5.3e-91 PTHR11649 MSS1/TRME-RELATED GTP-BINDING PROTEINMSS1/TRME-RELATED GTP-BINDING PROTEIN
PTHR11649:SF6[16-165]T 5.3e-91 PTHR11649:SF6 GTP-BINDING PROTEIN ERGGTP-BINDING PROTEIN ERG
seg[2-12]? NA seg seg[43-61]? NA seg segseg
SSF52540[12-99]T 1.3e-05 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

 

99.91

 

3475

 

2

 

1

 

645

 

4119

 

60713

 

64186

 

0

 

6857.0

 

AK247841

 

cttctcaatagcagtataaagcaagtgcaaaagctgattctgggttcttaaaatctgcatgtttttcttgcatttggattttgcataagctcagagttgaaagatttgtgaaatcttgatatgaaagctttaagagttttgaggacattgaactcatcactatcttcaaatccaagcaaaacccatttcaattcaaccattttccttcgattttactcagcccaacctcaagaagaccaccccacaagcactggtgtttcttcctctgaagaagaggacacgtcttcctcagtcttcgacagttcgcaatacgatgtgggtgtgggattaaacaatgatgttaattcagaaagaagtgtaagctccacttgggacgagaaatatagggaaagagtgaaaactaaagtctttggtgaagacccttccgagattaagagttcaagaatcttgattaaagaagaggagaagagaagaagagctgctttattggctaggactcttctagaagctgcactggaccggcctgatgaggaaggggacgaagataaagaggatgagttggtgaaggaagaagatcaaatgtcattgagtgtgggaattattggagctcctaatgctgggaaatcttcattgactaattacatggttgggaccaaagtttctgctgtatcacggaagacaaataccactactcatgaagtcttaggtgtgatgactaaagggaaaacacaaattgtgagtgtactttgaattactaggtttcagttccattttccctgattgttgatctccatttcattttatcagctttttgttgcttgagctgcatctatttgcaaaaatgaattctaatctccaatatacaataaatacatatatttttcatggactttagtttcatgtatgatcactgaactttactcgctgtattggtaaagagttatgtaaaataattggattttgtccactacaatagtgaagtcccaaactatcttttctcacatcaaagtgattaaactatgtttgaatagctcagaaaatcattaaatatcctgctcaaattagacaacatgataaaacaacaaccaataacatactccttgtaatcgcacaagtggggtgttggagggtagagtgtaagcagaacaacccttgtagagatagagaagttgtttctgatagaccctcagcttagagcctgccaaacaaaaaatacaaatgacagaaaatgaaaaattcatcgtgtaaaggctttgactactcatgttttacaattaaacaaaaaagtaaaaaagattacttggcactgggaattttgaccatccagtcaattctattttttgagcaattcagacatagttcagtcaaaaaaagaaaatgaagaaaacagctttgtgattttactattcttttggataaagtgccgttacattgatgtgacaaaaatattgttttgcaacttaactggtatacagggtacccatacgtaaaactgacccactaaatggtcaaaaattagttttcttggacttagagtaagattacccaagcttgatgtcagccatcgttctttttgaaaagggggtatgtactcttacctgcagcatcttatcaactgattttttttttttcctttttgaagaacttttttttattttaagggaaaattttcacaaaagagaaaataagcaaatatatgactactagcaaaaatgccaaatcttatgagcttatcttgcaggttgaagtatactttttgggtctaaaatatatggagagcaaaagttctatatgtctaatgagttctttctgcagtgtttctttgacactcccgggcttatgctaaagaaaagtggatttccttacaaagacataaaagcacgtattgaaagtgcatggaggtctattgatctatatgatgtactcattgtcatatttgatgctcataggcatcttaccaagttagtttttcttcttgcttcaactccaaaagttcatatttatgcaataactatatgctcatctcatgatattatgtatgcaacattgttatctgtaattactagtaatatatgatttaataatagaagaaaaaatatcgtaggctaagatgtgttttgcttgtttaatctggatatgtttgtctaattttcagattttcatcgttaggcgagttcacagaagaacgtagatagtgttttccatagtagttctcttaccccaagcctgcatgcacttacttcctatatttttggactagatagctctctaattggtatactagcccatgtcatatggtaagatgtgctttgcttgtttaatctggatatgttttgtctatttcatagttaggcgagttcacagaagaaggtagatagtgtttccacagtactacccttacccccaagcctgcatgtacttatttgcctgtatttttggactagatacctctctgattcatacactagtcaatgtcaattttatatcagtgtttttattaagcataaatcaaacagtcctatgcatacttttgcattcaccatcattaacaaggtgcaaatcatattaacattttaaaggggaatcttagtagcttagttggttggttactcccaccttgttggtgagggttcgattccccacattgagatcccctcccctatttccccttcccctacctccaatttttcaaaaataattgagaaaatattaacatcttaaatgtgcatagctcaaaatttgcacataatataggtggagggaatagaatttctgaatgatgatacacatcctctatgacttactcaaatagatgggctttggcctgtccaattttcttgctctgtaaataagatatttattgcaaccacaacaaactcagtgtagaaggctgtataaatactttatagaggtaagattataggtccagaagagaagttcagcttgaaatatatcaatgatgtaacacctgtgttttgcacgtcgaggaaagaaaactacttactccatcacaatcttgtcattataggctttttggcggttagtggaccatttctaagtgaattttgtccctttgagctttttgacagtcaactgatcaaccttgaactgaaatttgacttggataaagctcttatatgccggttggggtttatttttttgaagattcatcttcagtatcaagataatatgtgaagtaatctcatggtccaattaatttcctgtcaaattcgacttctgggccaatttttaccaacggtttttggtttttgttcaagggtaagcttctttccctacacaaaaacatgattcagattgtgtgttaagccttgataaaaattttctcgctttgatagagtaggcttccacttggaatagaaatgtgaggaccttccaagatcattgttgagattggtttgtcatttgtgaggacttcctgagatgattatttacttgtagaatgtagaatatgtagcagctagagtaggtttcctttcttctttgtagtcatgtgatgtgctatctccaaatgtctgtcactagtttctcaaggtgggatgctatttatgtctatctaatccttccttttcttttatattagaaactttttttttaatttgcaaattccaatctagggttatgatttccgaacttcgtatatgtatatatgctagcaaagctccaaatattgagtttttggtgtgaacagttaagttctgtgtcctttgagccaaatgagaggctttggaatttattctccccccggcatcaccttaagtagctctgttcagtgaagataggtatcggtttccatgtttaaaatgaagtaaacttatcgagaaaaaagtattgtagagaggactggaggatgcacatataactgcatcttatagcaactaagtagattcatctgaattttgctggcattatttcttctgtctaattttttgatatataggcctgattctcgagtggtgaggttgattgagagaatgggctctgaggctaatccaaatcagaaacgcttactgtgcatcaataaagttgacctaatcgagaaaaagaaagacttgttgaaagttgttgaggaattcaaagaccttcctggatatgaaaggtgctttacggtatccggactaaagggcgctggagtgaaagatctaactaaatacttgatggagcagtcagtgaaaagaccgtgggatgaagatccatttgtcatgagtgaagaagttatgaagaatatttcaatggaggtagtcagggaaaagttgctacattacatacatcaggaaatcccatatggcattgaccatcgcctgatggactggaaggagttacgtgatggttccctgagaattgaacaccatttgatcacacacaagataagccaacgcaagattctcgtaggaaagaatggttccaaaatagggagaataggtatcgaggcaaatgaagagttgagaacgatattcaagagaaatgtccatctaatgcttatggttagagtgaaatcatgaagatgaaagacaatatccttgttttgcatgtgtgtatatatagatgtgctccagtttttgtcccttaccaaagcagttctcagttgacacaataatttaccaaagcattaatccaaaattatattgttatgatacaaaatatggaagagaagcttgatttccctttacatgtgaatacactcatattcttttccatagatttaaggtcaaaattctagacattgtttgtattcatgttgggatca

 

3945

 

LEFL2029E19

1

ORF2

212

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

3475

0

6857.0

AK247841

Show
LEFL2029E19

LEFL2029E19

 

1

 

ORF2

 

6F4FE3EC4A646C4E

 

212

 

IPR002917

 

SEQUENCE: LEFL2029E19_1_ORF2CRC64: 6F4FE3EC4A646C4ELENGTH: 212 aa
InterPro
IPR002917
Domain
GTP-binding protein, HSR1-related
PFAMPF01926MMR_HSR1
 7.3e-11 [159-209]T    
Parentno parent
ChildrenIPR006073
Found inIPR004520
ContainsIPR005225
GO termsMolecular Function: GTP binding (GO:0005525)
Cellular Component: intracellular (GO:0005622)
noIPR
unintegrated
unintegrated
GENE3DG3D.3.40.50.300no description
 5.3e-14 [120-209]T    
PANTHERPTHR11649MSS1/TRME-RELATED GTP-BINDING PROTEIN
 3.9e-40 [86-208]T    
PANTHERPTHR11649:SF6GTP-BINDING PROTEIN ERG
 3.9e-40 [86-208]T    
SEGsegseg
 NA [45-69]?  NA [111-135]?  NA [139-155]?  
SUPERFAMILYSSF52540P-loop containing nucleoside triphosphate hydrolases
 1.6e-06 [157-202]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr02_finished_C02SLm0049G16.1.v1.seq_C02SLm0049G16.1

 

99.91

 

3475

 

2

 

1

 

645

 

4119

 

60713

 

64186

 

0

 

6857.0

 

AK247841

 

cttctcaatagcagtataaagcaagtgcaaaagctgattctgggttcttaaaatctgcatgtttttcttgcatttggattttgcataagctcagagttgaaagatttgtgaaatcttgatatgaaagctttaagagttttgaggacattgaactcatcactatcttcaaatccaagcaaaacccatttcaattcaaccattttccttcgattttactcagcccaacctcaagaagaccaccccacaagcactggtgtttcttcctctgaagaagaggacacgtcttcctcagtcttcgacagttcgcaatacgatgtgggtgtgggattaaacaatgatgttaattcagaaagaagtgtaagctccacttgggacgagaaatatagggaaagagtgaaaactaaagtctttggtgaagacccttccgagattaagagttcaagaatcttgattaaagaagaggagaagagaagaagagctgctttattggctaggactcttctagaagctgcactggaccggcctgatgaggaaggggacgaagataaagaggatgagttggtgaaggaagaagatcaaatgtcattgagtgtgggaattattggagctcctaatgctgggaaatcttcattgactaattacatggttgggaccaaagtttctgctgtatcacggaagacaaataccactactcatgaagtcttaggtgtgatgactaaagggaaaacacaaattgtgagtgtactttgaattactaggtttcagttccattttccctgattgttgatctccatttcattttatcagctttttgttgcttgagctgcatctatttgcaaaaatgaattctaatctccaatatacaataaatacatatatttttcatggactttagtttcatgtatgatcactgaactttactcgctgtattggtaaagagttatgtaaaataattggattttgtccactacaatagtgaagtcccaaactatcttttctcacatcaaagtgattaaactatgtttgaatagctcagaaaatcattaaatatcctgctcaaattagacaacatgataaaacaacaaccaataacatactccttgtaatcgcacaagtggggtgttggagggtagagtgtaagcagaacaacccttgtagagatagagaagttgtttctgatagaccctcagcttagagcctgccaaacaaaaaatacaaatgacagaaaatgaaaaattcatcgtgtaaaggctttgactactcatgttttacaattaaacaaaaaagtaaaaaagattacttggcactgggaattttgaccatccagtcaattctattttttgagcaattcagacatagttcagtcaaaaaaagaaaatgaagaaaacagctttgtgattttactattcttttggataaagtgccgttacattgatgtgacaaaaatattgttttgcaacttaactggtatacagggtacccatacgtaaaactgacccactaaatggtcaaaaattagttttcttggacttagagtaagattacccaagcttgatgtcagccatcgttctttttgaaaagggggtatgtactcttacctgcagcatcttatcaactgattttttttttttcctttttgaagaacttttttttattttaagggaaaattttcacaaaagagaaaataagcaaatatatgactactagcaaaaatgccaaatcttatgagcttatcttgcaggttgaagtatactttttgggtctaaaatatatggagagcaaaagttctatatgtctaatgagttctttctgcagtgtttctttgacactcccgggcttatgctaaagaaaagtggatttccttacaaagacataaaagcacgtattgaaagtgcatggaggtctattgatctatatgatgtactcattgtcatatttgatgctcataggcatcttaccaagttagtttttcttcttgcttcaactccaaaagttcatatttatgcaataactatatgctcatctcatgatattatgtatgcaacattgttatctgtaattactagtaatatatgatttaataatagaagaaaaaatatcgtaggctaagatgtgttttgcttgtttaatctggatatgtttgtctaattttcagattttcatcgttaggcgagttcacagaagaacgtagatagtgttttccatagtagttctcttaccccaagcctgcatgcacttacttcctatatttttggactagatagctctctaattggtatactagcccatgtcatatggtaagatgtgctttgcttgtttaatctggatatgttttgtctatttcatagttaggcgagttcacagaagaaggtagatagtgtttccacagtactacccttacccccaagcctgcatgtacttatttgcctgtatttttggactagatacctctctgattcatacactagtcaatgtcaattttatatcagtgtttttattaagcataaatcaaacagtcctatgcatacttttgcattcaccatcattaacaaggtgcaaatcatattaacattttaaaggggaatcttagtagcttagttggttggttactcccaccttgttggtgagggttcgattccccacattgagatcccctcccctatttccccttcccctacctccaatttttcaaaaataattgagaaaatattaacatcttaaatgtgcatagctcaaaatttgcacataatataggtggagggaatagaatttctgaatgatgatacacatcctctatgacttactcaaatagatgggctttggcctgtccaattttcttgctctgtaaataagatatttattgcaaccacaacaaactcagtgtagaaggctgtataaatactttatagaggtaagattataggtccagaagagaagttcagcttgaaatatatcaatgatgtaacacctgtgttttgcacgtcgaggaaagaaaactacttactccatcacaatcttgtcattataggctttttggcggttagtggaccatttctaagtgaattttgtccctttgagctttttgacagtcaactgatcaaccttgaactgaaatttgacttggataaagctcttatatgccggttggggtttatttttttgaagattcatcttcagtatcaagataatatgtgaagtaatctcatggtccaattaatttcctgtcaaattcgacttctgggccaatttttaccaacggtttttggtttttgttcaagggtaagcttctttccctacacaaaaacatgattcagattgtgtgttaagccttgataaaaattttctcgctttgatagagtaggcttccacttggaatagaaatgtgaggaccttccaagatcattgttgagattggtttgtcatttgtgaggacttcctgagatgattatttacttgtagaatgtagaatatgtagcagctagagtaggtttcctttcttctttgtagtcatgtgatgtgctatctccaaatgtctgtcactagtttctcaaggtgggatgctatttatgtctatctaatccttccttttcttttatattagaaactttttttttaatttgcaaattccaatctagggttatgatttccgaacttcgtatatgtatatatgctagcaaagctccaaatattgagtttttggtgtgaacagttaagttctgtgtcctttgagccaaatgagaggctttggaatttattctccccccggcatcaccttaagtagctctgttcagtgaagataggtatcggtttccatgtttaaaatgaagtaaacttatcgagaaaaaagtattgtagagaggactggaggatgcacatataactgcatcttatagcaactaagtagattcatctgaattttgctggcattatttcttctgtctaattttttgatatataggcctgattctcgagtggtgaggttgattgagagaatgggctctgaggctaatccaaatcagaaacgcttactgtgcatcaataaagttgacctaatcgagaaaaagaaagacttgttgaaagttgttgaggaattcaaagaccttcctggatatgaaaggtgctttacggtatccggactaaagggcgctggagtgaaagatctaactaaatacttgatggagcagtcagtgaaaagaccgtgggatgaagatccatttgtcatgagtgaagaagttatgaagaatatttcaatggaggtagtcagggaaaagttgctacattacatacatcaggaaatcccatatggcattgaccatcgcctgatggactggaaggagttacgtgatggttccctgagaattgaacaccatttgatcacacacaagataagccaacgcaagattctcgtaggaaagaatggttccaaaatagggagaataggtatcgaggcaaatgaagagttgagaacgatattcaagagaaatgtccatctaatgcttatggttagagtgaaatcatgaagatgaaagacaatatccttgttttgcatgtgtgtatatatagatgtgctccagtttttgtcccttaccaaagcagttctcagttgacacaataatttaccaaagcattaatccaaaattatattgttatgatacaaaatatggaagagaagcttgatttccctttacatgtgaatacactcatattcttttccatagatttaaggtcaaaattctagacattgtttgtattcatgttgggatca

 

3946

 

LEFL2010F19

3

ORF2

118

chr02_finished_C02HBa0016A12.1.v1.seq_C02HBa0016A12.1

2699

0

5342.0

AK247771

Show
LEFL2010F19

LEFL2010F19

 

3

 

ORF2

 

7A7CEF1ABBBB41E3

 

118

 

IPR006140

 

SEQUENCE: LEFL2010F19_3_ORF2CRC64: 7A7CEF1ABBBB41E3LENGTH: 118 aa
InterPro
IPR006140
Domain
D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
PF02826[2-74]T 1.9e-25 PF02826 2-Hacid_dh_C2-Hacid_dh_C
PS00671[13-29]T 8e-5 PS00671 D_2_HYDROXYACID_DH_3D_2_HYDROXYACID_DH_3
noIPR
unintegrated
unintegrated
G3D.3.40.50.720[16-114]T 9.4e-26 G3D.3.40.50.720 no descriptionno description
PTHR10996[1-114]T 6.8e-78 PTHR10996 2-HYDROXYACID DEHYDROGENASE2-HYDROXYACID DEHYDROGENASE
PTHR10996:SF16[1-114]T 6.8e-78 PTHR10996:SF16 FORMATE DEHYDROGENASEFORMATE DEHYDROGENASE
SSF51735[1-75]T 1.1e-21 SSF51735 NAD(P)-binding Rossmann-fold domainsNAD(P)-binding Rossmann-fold domains

 

chr02_finished_C02HBa0016A12.1.v1.seq_C02HBa0016A12.1

 

99.96

 

2699

 

1

 

0

 

975

 

3673

 

78600

 

75902

 

0

 

5342.0

 

AK247771

 

taaggtttctgtttctgtaattacccgtcgtaaacctatacaataatatttattgacaaagcttcttatattcaagttattttaacaatgacttaattatgaaatgaactaagtaagctaaagtgaatattcattgagaatgaaatatgatatttagcgaagggaaggagaatctttggtgtcatcgtaattttttggtatcactctagatcatatataaagtagttgtatatttagattccccgattgtattccctaagttaagaaattctcttgagcatccaccatatactatgatacatgactttggctaagctcaaaaagactatctcaatgatggccctccatggattctccacctatataagccacggctaaagaaaaattgcttggccaagttgtcttttacctttggcatgatgcaaaaaacatttgatattctttctgtgtgaaccactgctacgagtaatatgttcttagagatcatgttttctttttgttcttcctttaattttctatttgaagatttgtcatcagttagaggtcatcggtaggatgatagatgttctcagcaacttgtgttgccagaataatatgattgccaatggagtatttttaagattcttggagatgtaagagttgtttctgtccatacatcactcttctcatgtcactaaggtcattgattgtttccatgtgctatatcgcaaattgctccaattttaactatgtgatccagaggaatgtttgacaaggaaagaattgcaaagttgaagaagggagttctaattgtaaacaatgctcgaggagcaattatggacactcaagcagttgttgatgcttgtaacagcggtcatattgcaggatacagtggggatgtttggtacccacaaccagctcccaaggaccatctatggcgttacatgccaaaccaagctatgactcctcacatttctgggactaccattgatgcacagttgaggtatgcagctggaacaaaggatatgttggacaggtacttcaagggtgaggatttccctgctgaaaattacattgtcaaggatggggaattggcacctcagtatcgctaaattatttatgtatagagttgtgtctagatttctgtgttaaataaactggcaagccgtgtcttcaataagctgataaaattggctactttatgttcttctagaactctaatgcagtttttctccgggttagctgtaacttttgtgatggaaacatatgtcctcttctgtgatggaggtctatgtatgatcctccagtgtctttcttgagtctataactgaacttccttgctgtggtagttgtactggtgttcctggacattttatgttttaaaaaaaattatcttcttgtttgctagtatttgttgcagtcgctaggttaatcttttctacgacgccaggaaaaacttggcagaaataatgaaatgatgtgaaacagaatttgacatcacagtatattttgctttattgggaagaaaagccgacttcatcagtctggaacttcagatttttaaacgacctctttcttcacatacaagcgaataaatgcgatatatgcgccatttgacacccaagttggagtggttcattttacagttacgcttttttgtctataataaaaaagtcaattagtatataacatgtttgaattagatcttaaatctaattcacactccaaaagctagttctagttcaaaaggaggaattttcaagccttaataaggagtttactcattttcgacgtgagactgtcgtcattaacattacagttatagtaataggtaatttttgaatacaaatcagagccactatatctttcaagtgcaagtagaaaatgcagactgatcacaaaagaaagagagcaggcagcatacacatgcaatgttttttaattagttggcgacattgtgcgaagaagatttgtcattcatgacatgtggctgtgatttcctataccgaatgtttgtgggataatcttcctgttggtgttagtcaccagtacctaaaatttactttaaaaatgatgataaatttcatgcctcactgattcaaactgttttgcttaagaaattcaaggtctttcatttgcatctgaactgcttcttttgataattgcttgggctcatatttgatttcttcagttccatctgccattctctttgccttctctttgacaatgatttctaccttttgccgcccgactgtaggaaagacagcattaagcatggtacttagcagtttttcatcttcttcatcaatcagatcccttccatagcaacacacatgtatagcttcaagagctttctcagcacgaaattccatggggattgtaggtgctggagctcccaactttgatcgcttctgcacgagtaaaggaaaatgttagcaaaaatggtactgggtataacactggaccataaacgagagttcaaatataagtgtgatatatggctatcaaaccgtgcacattctgtgcttggtgctaaatctaatgaagcccgtaatgggatagctgcaaacataaatttactcgatatactattgtaagcaagcttcccaataagagttaggcagagctatgctgcttgaatcgtccaagaatactgtctgcatgtgtcgatactctaaaatatatgcagttttggaggattcgaacaacatggaggcagagttctaagtaccacatcaaaagaatgaagcataaacagaagttgaagtatgcctcaaagacagtatccgagtaagtatgctataaatttactgataagcattgaaagtaaggtaacataaatgaaaagaagctaaaaatcgttggcaaatgaaatcttacgaacctcccttgcttcattcatcattgcgatgaagttttgttcttcaaattcaatatcatttgctaaactaagccttgctaccccttccaaaatttcctcagatttgagtaaaccagctcctactgcagctaaccaacaacacagtagcacatacagaggatcccctgtctatcaataaggcaaggaaaatcaaggtcaataatctatagataaaaccaagtcacttgattgcaagtaaaaattaccttgccacgtcgatctcgaaattcataaaaagctcttgaatcattaatggaacacttgttaccgactcgcctcctgaactccgcaaaatcaataaaatcgcctccaacaccaccttcctcattgacaattctggctatgagaccaaaaacaggcagtgaaccgatgaccttattagcaaaactagaaattggatttgtggtctcatccatataagccttgacgagcaagaccgcaccgccattggagttggaattatttcttctggatggaaatgtatagaaacgtcgaaagtaacgaagagagggagagattgagttacagtagatggaggaggaagaagaaggagagtggagagaggagacaaccaccatagtgttacatgtggtggacgttcaatctttgttttgatatttgccccttttgtttatcttttcggaatctatctcgctatgagcttcattatctaactctcaaataataataatattagtaatacagttaaaaaaattaaaatcatctactttttcgtagcccttttgattaaattaaatttatttaaatacttaa

 

3444

 

LEFL2010F19

3

ORF2

118

chr02_finished_C02HBa0016A12.1.v1.seq_C02HBa0016A12.1

2699

0

5342.0

AK247771

Show
LEFL2010F19

LEFL2010F19

 

3

 

ORF2

 

7A7CEF1ABBBB41E3

 

118

 

IPR006140

 

SEQUENCE: LEFL2010F19_3_ORF2CRC64: 7A7CEF1ABBBB41E3LENGTH: 118 aa
InterPro
IPR006140
Domain
D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
PF02826[2-74]T 1.9e-25 PF02826 2-Hacid_dh_C2-Hacid_dh_C
PS00671[13-29]T 8e-5 PS00671 D_2_HYDROXYACID_DH_3D_2_HYDROXYACID_DH_3
noIPR
unintegrated
unintegrated
G3D.3.40.50.720[16-114]T 9.4e-26 G3D.3.40.50.720 no descriptionno description
PTHR10996[1-114]T 6.8e-78 PTHR10996 2-HYDROXYACID DEHYDROGENASE2-HYDROXYACID DEHYDROGENASE
PTHR10996:SF16[1-114]T 6.8e-78 PTHR10996:SF16 FORMATE DEHYDROGENASEFORMATE DEHYDROGENASE
SSF51735[1-75]T 1.1e-21 SSF51735 NAD(P)-binding Rossmann-fold domainsNAD(P)-binding Rossmann-fold domains

 

chr02_finished_C02HBa0016A12.1.v1.seq_C02HBa0016A12.1

 

99.96

 

2699

 

1

 

0

 

975

 

3673

 

78600

 

75902

 

0

 

5342.0

 

AK247771

 

taaggtttctgtttctgtaattacccgtcgtaaacctatacaataatatttattgacaaagcttcttatattcaagttattttaacaatgacttaattatgaaatgaactaagtaagctaaagtgaatattcattgagaatgaaatatgatatttagcgaagggaaggagaatctttggtgtcatcgtaattttttggtatcactctagatcatatataaagtagttgtatatttagattccccgattgtattccctaagttaagaaattctcttgagcatccaccatatactatgatacatgactttggctaagctcaaaaagactatctcaatgatggccctccatggattctccacctatataagccacggctaaagaaaaattgcttggccaagttgtcttttacctttggcatgatgcaaaaaacatttgatattctttctgtgtgaaccactgctacgagtaatatgttcttagagatcatgttttctttttgttcttcctttaattttctatttgaagatttgtcatcagttagaggtcatcggtaggatgatagatgttctcagcaacttgtgttgccagaataatatgattgccaatggagtatttttaagattcttggagatgtaagagttgtttctgtccatacatcactcttctcatgtcactaaggtcattgattgtttccatgtgctatatcgcaaattgctccaattttaactatgtgatccagaggaatgtttgacaaggaaagaattgcaaagttgaagaagggagttctaattgtaaacaatgctcgaggagcaattatggacactcaagcagttgttgatgcttgtaacagcggtcatattgcaggatacagtggggatgtttggtacccacaaccagctcccaaggaccatctatggcgttacatgccaaaccaagctatgactcctcacatttctgggactaccattgatgcacagttgaggtatgcagctggaacaaaggatatgttggacaggtacttcaagggtgaggatttccctgctgaaaattacattgtcaaggatggggaattggcacctcagtatcgctaaattatttatgtatagagttgtgtctagatttctgtgttaaataaactggcaagccgtgtcttcaataagctgataaaattggctactttatgttcttctagaactctaatgcagtttttctccgggttagctgtaacttttgtgatggaaacatatgtcctcttctgtgatggaggtctatgtatgatcctccagtgtctttcttgagtctataactgaacttccttgctgtggtagttgtactggtgttcctggacattttatgttttaaaaaaaattatcttcttgtttgctagtatttgttgcagtcgctaggttaatcttttctacgacgccaggaaaaacttggcagaaataatgaaatgatgtgaaacagaatttgacatcacagtatattttgctttattgggaagaaaagccgacttcatcagtctggaacttcagatttttaaacgacctctttcttcacatacaagcgaataaatgcgatatatgcgccatttgacacccaagttggagtggttcattttacagttacgcttttttgtctataataaaaaagtcaattagtatataacatgtttgaattagatcttaaatctaattcacactccaaaagctagttctagttcaaaaggaggaattttcaagccttaataaggagtttactcattttcgacgtgagactgtcgtcattaacattacagttatagtaataggtaatttttgaatacaaatcagagccactatatctttcaagtgcaagtagaaaatgcagactgatcacaaaagaaagagagcaggcagcatacacatgcaatgttttttaattagttggcgacattgtgcgaagaagatttgtcattcatgacatgtggctgtgatttcctataccgaatgtttgtgggataatcttcctgttggtgttagtcaccagtacctaaaatttactttaaaaatgatgataaatttcatgcctcactgattcaaactgttttgcttaagaaattcaaggtctttcatttgcatctgaactgcttcttttgataattgcttgggctcatatttgatttcttcagttccatctgccattctctttgccttctctttgacaatgatttctaccttttgccgcccgactgtaggaaagacagcattaagcatggtacttagcagtttttcatcttcttcatcaatcagatcccttccatagcaacacacatgtatagcttcaagagctttctcagcacgaaattccatggggattgtaggtgctggagctcccaactttgatcgcttctgcacgagtaaaggaaaatgttagcaaaaatggtactgggtataacactggaccataaacgagagttcaaatataagtgtgatatatggctatcaaaccgtgcacattctgtgcttggtgctaaatctaatgaagcccgtaatgggatagctgcaaacataaatttactcgatatactattgtaagcaagcttcccaataagagttaggcagagctatgctgcttgaatcgtccaagaatactgtctgcatgtgtcgatactctaaaatatatgcagttttggaggattcgaacaacatggaggcagagttctaagtaccacatcaaaagaatgaagcataaacagaagttgaagtatgcctcaaagacagtatccgagtaagtatgctataaatttactgataagcattgaaagtaaggtaacataaatgaaaagaagctaaaaatcgttggcaaatgaaatcttacgaacctcccttgcttcattcatcattgcgatgaagttttgttcttcaaattcaatatcatttgctaaactaagccttgctaccccttccaaaatttcctcagatttgagtaaaccagctcctactgcagctaaccaacaacacagtagcacatacagaggatcccctgtctatcaataaggcaaggaaaatcaaggtcaataatctatagataaaaccaagtcacttgattgcaagtaaaaattaccttgccacgtcgatctcgaaattcataaaaagctcttgaatcattaatggaacacttgttaccgactcgcctcctgaactccgcaaaatcaataaaatcgcctccaacaccaccttcctcattgacaattctggctatgagaccaaaaacaggcagtgaaccgatgaccttattagcaaaactagaaattggatttgtggtctcatccatataagccttgacgagcaagaccgcaccgccattggagttggaattatttcttctggatggaaatgtatagaaacgtcgaaagtaacgaagagagggagagattgagttacagtagatggaggaggaagaagaaggagagtggagagaggagacaaccaccatagtgttacatgtggtggacgttcaatctttgttttgatatttgccccttttgtttatcttttcggaatctatctcgctatgagcttcattatctaactctcaaataataataatattagtaatacagttaaaaaaattaaaatcatctactttttcgtagcccttttgattaaattaaatttatttaaatacttaa

 

3445

 

LEFL2010F19

3

ORF2

118

chr02_finished_C02HBa0016A12.1.v1.seq_C02HBa0016A12.1

2699

0

5342.0

AK247771

Show
LEFL2010F19

LEFL2010F19

 

3

 

ORF2

 

7A7CEF1ABBBB41E3

 

118

 

IPR006140

 

SEQUENCE: LEFL2010F19_3_ORF2CRC64: 7A7CEF1ABBBB41E3LENGTH: 118 aa
InterPro
IPR006140
Domain
D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding
PFAMPF028262-Hacid_dh_C
 1.9e-25 [2-74]T    
PROSITEPS00671D_2_HYDROXYACID_DH_3
 8e-5 [13-29]T    
Parentno parent
Childrenno children
Found inIPR006236
Containsno entries
GO termsBiological Process: L-serine biosynthesis (GO:0006564)
noIPR
unintegrated
unintegrated
GENE3DG3D.3.40.50.720no description
 9.4e-26 [16-114]T    
PANTHERPTHR109962-HYDROXYACID DEHYDROGENASE
 6.8e-78 [1-114]T    
PANTHERPTHR10996:SF16FORMATE DEHYDROGENASE
 6.8e-78 [1-114]T    
SUPERFAMILYSSF51735NAD(P)-binding Rossmann-fold domains
 1.1e-21 [1-75]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr02_finished_C02HBa0016A12.1.v1.seq_C02HBa0016A12.1

 

99.96

 

2699

 

1

 

0

 

975

 

3673

 

78600

 

75902

 

0

 

5342.0

 

AK247771

 

taaggtttctgtttctgtaattacccgtcgtaaacctatacaataatatttattgacaaagcttcttatattcaagttattttaacaatgacttaattatgaaatgaactaagtaagctaaagtgaatattcattgagaatgaaatatgatatttagcgaagggaaggagaatctttggtgtcatcgtaattttttggtatcactctagatcatatataaagtagttgtatatttagattccccgattgtattccctaagttaagaaattctcttgagcatccaccatatactatgatacatgactttggctaagctcaaaaagactatctcaatgatggccctccatggattctccacctatataagccacggctaaagaaaaattgcttggccaagttgtcttttacctttggcatgatgcaaaaaacatttgatattctttctgtgtgaaccactgctacgagtaatatgttcttagagatcatgttttctttttgttcttcctttaattttctatttgaagatttgtcatcagttagaggtcatcggtaggatgatagatgttctcagcaacttgtgttgccagaataatatgattgccaatggagtatttttaagattcttggagatgtaagagttgtttctgtccatacatcactcttctcatgtcactaaggtcattgattgtttccatgtgctatatcgcaaattgctccaattttaactatgtgatccagaggaatgtttgacaaggaaagaattgcaaagttgaagaagggagttctaattgtaaacaatgctcgaggagcaattatggacactcaagcagttgttgatgcttgtaacagcggtcatattgcaggatacagtggggatgtttggtacccacaaccagctcccaaggaccatctatggcgttacatgccaaaccaagctatgactcctcacatttctgggactaccattgatgcacagttgaggtatgcagctggaacaaaggatatgttggacaggtacttcaagggtgaggatttccctgctgaaaattacattgtcaaggatggggaattggcacctcagtatcgctaaattatttatgtatagagttgtgtctagatttctgtgttaaataaactggcaagccgtgtcttcaataagctgataaaattggctactttatgttcttctagaactctaatgcagtttttctccgggttagctgtaacttttgtgatggaaacatatgtcctcttctgtgatggaggtctatgtatgatcctccagtgtctttcttgagtctataactgaacttccttgctgtggtagttgtactggtgttcctggacattttatgttttaaaaaaaattatcttcttgtttgctagtatttgttgcagtcgctaggttaatcttttctacgacgccaggaaaaacttggcagaaataatgaaatgatgtgaaacagaatttgacatcacagtatattttgctttattgggaagaaaagccgacttcatcagtctggaacttcagatttttaaacgacctctttcttcacatacaagcgaataaatgcgatatatgcgccatttgacacccaagttggagtggttcattttacagttacgcttttttgtctataataaaaaagtcaattagtatataacatgtttgaattagatcttaaatctaattcacactccaaaagctagttctagttcaaaaggaggaattttcaagccttaataaggagtttactcattttcgacgtgagactgtcgtcattaacattacagttatagtaataggtaatttttgaatacaaatcagagccactatatctttcaagtgcaagtagaaaatgcagactgatcacaaaagaaagagagcaggcagcatacacatgcaatgttttttaattagttggcgacattgtgcgaagaagatttgtcattcatgacatgtggctgtgatttcctataccgaatgtttgtgggataatcttcctgttggtgttagtcaccagtacctaaaatttactttaaaaatgatgataaatttcatgcctcactgattcaaactgttttgcttaagaaattcaaggtctttcatttgcatctgaactgcttcttttgataattgcttgggctcatatttgatttcttcagttccatctgccattctctttgccttctctttgacaatgatttctaccttttgccgcccgactgtaggaaagacagcattaagcatggtacttagcagtttttcatcttcttcatcaatcagatcccttccatagcaacacacatgtatagcttcaagagctttctcagcacgaaattccatggggattgtaggtgctggagctcccaactttgatcgcttctgcacgagtaaaggaaaatgttagcaaaaatggtactgggtataacactggaccataaacgagagttcaaatataagtgtgatatatggctatcaaaccgtgcacattctgtgcttggtgctaaatctaatgaagcccgtaatgggatagctgcaaacataaatttactcgatatactattgtaagcaagcttcccaataagagttaggcagagctatgctgcttgaatcgtccaagaatactgtctgcatgtgtcgatactctaaaatatatgcagttttggaggattcgaacaacatggaggcagagttctaagtaccacatcaaaagaatgaagcataaacagaagttgaagtatgcctcaaagacagtatccgagtaagtatgctataaatttactgataagcattgaaagtaaggtaacataaatgaaaagaagctaaaaatcgttggcaaatgaaatcttacgaacctcccttgcttcattcatcattgcgatgaagttttgttcttcaaattcaatatcatttgctaaactaagccttgctaccccttccaaaatttcctcagatttgagtaaaccagctcctactgcagctaaccaacaacacagtagcacatacagaggatcccctgtctatcaataaggcaaggaaaatcaaggtcaataatctatagataaaaccaagtcacttgattgcaagtaaaaattaccttgccacgtcgatctcgaaattcataaaaagctcttgaatcattaatggaacacttgttaccgactcgcctcctgaactccgcaaaatcaataaaatcgcctccaacaccaccttcctcattgacaattctggctatgagaccaaaaacaggcagtgaaccgatgaccttattagcaaaactagaaattggatttgtggtctcatccatataagccttgacgagcaagaccgcaccgccattggagttggaattatttcttctggatggaaatgtatagaaacgtcgaaagtaacgaagagagggagagattgagttacagtagatggaggaggaagaagaaggagagtggagagaggagacaaccaccatagtgttacatgtggtggacgttcaatctttgttttgatatttgccccttttgtttatcttttcggaatctatctcgctatgagcttcattatctaactctcaaataataataatattagtaatacagttaaaaaaattaaaatcatctactttttcgtagcccttttgattaaattaaatttatttaaatacttaa

 

3446

 

LEFL1067CD12

5

ORF6

141

chr02_finished_C02HBa0172G12.1.v1.seq_C02HBa0172G12.1

2476

0

4908.0

AK247232

Show
LEFL1067CD12

LEFL1067CD12

 

5

 

ORF6

 

D8AA0208670CEAA0

 

141

 

IPR001545

 

SEQUENCE: LEFL1067CD12_5_ORF6CRC64: D8AA0208670CEAA0LENGTH: 141 aa
InterPro
IPR001545
Family
Gonadotropin, beta chain
PS00261[98-104]? NA PS00261 GLYCO_HORMONE_BETA_1GLYCO_HORMONE_BETA_1
noIPR
unintegrated
unintegrated
seg[1-23]? NA seg segseg

 

chr02_finished_C02HBa0172G12.1.v1.seq_C02HBa0172G12.1

 

100.0

 

2476

 

0

 

0

 

156

 

2631

 

26199

 

23724

 

0

 

4908.0

 

AK247232

 

aacgtttttcgtttttggcccttgacactaaacaaacaggccctaacacgctttctgtaacaaaaacccactgcctctttttgagaagaaaattccagaagaaaagtttagacgtcgcttgcacgatcgctgttgctgttgctgagtagattacacagggttttggaatttgaatcttgatggctgaggataacacagatgaacttgccagtccagcagcaagtgtgaagaatgactctatggctgaggataacaccgatgaattaatgagtccagtagctagtgtgaagaatgactccatggccgaggataacactgatgaactagtgaatccagtaactagtgtggaaagtgactctgctggaagtaaaccagatagaatcagcacaagaaaatcaggttctctgagtaatgctcacaaggttcttcccttctatcgcaactcctcctctacatctaataatggaggtaatacaagaaggcaatccactgggaagttgcattctcctgacagtggacaagatgttcttcctcattatctgcgagcttccactggttcttgccatgacttttgtaaatatggcaagaagcattcctctgaaccaaagccatggcattctctatcaaaaagaaagaacaaacttcccgctgatgagcagagtcctgcacaggccttggtgggagaggctaaaaaggggacttcggtcaagcagaagccttccactcctccagggagtgtgctgggagagaaaaagaaggtaactggagttgaccaaaaaccttccacttctccagggagtatgctgggagagtcaaagaaaaggattgtggtcaagcaaaacactttcactacttcagggagtagccagggagaggcaaagaaggggatgttggtcaagaaaaagcctcccactcctccaaggagtatgctggaagaggaaaagaaggtggatgtgataaatcaaaagccttcagcacctcaggagagtatacttgaagatgacaagaaggtggctatggttgagcaaaagccttcttctcctccaggtagcatacagggaggggtggatgaggtgactgtggttgatcaaaattcttcagcttctctggagagtatgctaggagagggagaaataatgactgcagttgagcaaaagctttctactccttcagggagtgcgctggtagcgggagagaaagtgactctggtcaatcaaaaatcatccgctcctccagggagtatgctaggacagggaaataagttgaatgtggtcgatcaaagacctccttccaaggttcattctcttgaaccttcagaaatgataaagaaaaaggcaacgctgccaccaaagagtgttcactctctgaaattggattcctcaagttacaagatgccagagacagagaagaaaatgaaacctgttttggtaaagcattctcctcctgagcagacaaagctcaaaatggtaaaatcttcatctaagatcttgggaggtgtagatgcagggttcagaaaagtcggcgctgttaattctagaaaacaaaaaattgtgtctaaagtatctggggagaagtctttgaagatcccaactcattcatgttctccaaaatcttcctctgttaaacctttgatcttgagggcaagaaacagtataagccttaaactgctgtctccgctgaaggaccagaacaagatgtggagagatggaacgaacaaaccaaagtctgcctcccagtcacaatcacatttgttgtctactgaagtggataaaaaagttgctaagtctgcaggcagtgcatcaggtaaatacacatctagcagcaaaaagttgttacacatagcagaggcagaaactgatgggaaaaatcagaaaaagacattgaggaaaggcaagacagctgtttctaatgatcaaaatccttcagtggtgaaactgaaattcaggaggggtaaggtaattgatctccagccagaaaccagcagccctaggaggctgacatttagattgggacgacatatgggtgaaagccaggacagtaatataagaaagagaaattttagaaagaaaggagttgatgatgacggaagtaatactatccctaactccagaaaaattgttttgaggcatcaggatgtgcaggaaaagaaagatgtgcagggtttgttgaataatgtgattgaagagacggcgagtaagcttgttgaaaccaggaaaagcaaggttaaagctttggtgggagcttttgagacagttatttccctccaagataaaccttctacagtaacagtttcttgattaacaaccataaatttctaacacataggagcaattgcaaatatagtggatgatataacttttctgacctggtttaagtatgtttgtcgtgtttctcattctgactcatcgtcttaacgatttcttgatggctttctggttctgttctcttgattgaataaattcagtttcatctggatgcacctacttggaattgagagattaagtcgcgtaagattgtgaactttttatcacttatggaggctgtgattgttgtgttagatcttagatcagtaggtgtttgcgtaatttctatgttgagctggttgctcagtgaacatatattgctgttgga

 

1632

 

LEFL1067CD12

3

ORF2

707

chr02_finished_C02HBa0172G12.1.v1.seq_C02HBa0172G12.1

2476

0

4908.0

AK247232

Show
LEFL1067CD12

LEFL1067CD12

 

3

 

ORF2

 

97D3F0E908C546B7

 

707

 

IPR012417

 

SEQUENCE: LEFL1067CD12_3_ORF2CRC64: 97D3F0E908C546B7LENGTH: 707 aa
InterPro
IPR012417
Family
Calmodulin-binding, plant
PF07839[584-696]T 3.5e-29 PF07839 CaM_bindingCaM_binding
noIPR
unintegrated
unintegrated
seg[89-103]? NA seg segseg

 

chr02_finished_C02HBa0172G12.1.v1.seq_C02HBa0172G12.1

 

100.0

 

2476

 

0

 

0

 

156

 

2631

 

26199

 

23724

 

0

 

4908.0

 

AK247232

 

aacgtttttcgtttttggcccttgacactaaacaaacaggccctaacacgctttctgtaacaaaaacccactgcctctttttgagaagaaaattccagaagaaaagtttagacgtcgcttgcacgatcgctgttgctgttgctgagtagattacacagggttttggaatttgaatcttgatggctgaggataacacagatgaacttgccagtccagcagcaagtgtgaagaatgactctatggctgaggataacaccgatgaattaatgagtccagtagctagtgtgaagaatgactccatggccgaggataacactgatgaactagtgaatccagtaactagtgtggaaagtgactctgctggaagtaaaccagatagaatcagcacaagaaaatcaggttctctgagtaatgctcacaaggttcttcccttctatcgcaactcctcctctacatctaataatggaggtaatacaagaaggcaatccactgggaagttgcattctcctgacagtggacaagatgttcttcctcattatctgcgagcttccactggttcttgccatgacttttgtaaatatggcaagaagcattcctctgaaccaaagccatggcattctctatcaaaaagaaagaacaaacttcccgctgatgagcagagtcctgcacaggccttggtgggagaggctaaaaaggggacttcggtcaagcagaagccttccactcctccagggagtgtgctgggagagaaaaagaaggtaactggagttgaccaaaaaccttccacttctccagggagtatgctgggagagtcaaagaaaaggattgtggtcaagcaaaacactttcactacttcagggagtagccagggagaggcaaagaaggggatgttggtcaagaaaaagcctcccactcctccaaggagtatgctggaagaggaaaagaaggtggatgtgataaatcaaaagccttcagcacctcaggagagtatacttgaagatgacaagaaggtggctatggttgagcaaaagccttcttctcctccaggtagcatacagggaggggtggatgaggtgactgtggttgatcaaaattcttcagcttctctggagagtatgctaggagagggagaaataatgactgcagttgagcaaaagctttctactccttcagggagtgcgctggtagcgggagagaaagtgactctggtcaatcaaaaatcatccgctcctccagggagtatgctaggacagggaaataagttgaatgtggtcgatcaaagacctccttccaaggttcattctcttgaaccttcagaaatgataaagaaaaaggcaacgctgccaccaaagagtgttcactctctgaaattggattcctcaagttacaagatgccagagacagagaagaaaatgaaacctgttttggtaaagcattctcctcctgagcagacaaagctcaaaatggtaaaatcttcatctaagatcttgggaggtgtagatgcagggttcagaaaagtcggcgctgttaattctagaaaacaaaaaattgtgtctaaagtatctggggagaagtctttgaagatcccaactcattcatgttctccaaaatcttcctctgttaaacctttgatcttgagggcaagaaacagtataagccttaaactgctgtctccgctgaaggaccagaacaagatgtggagagatggaacgaacaaaccaaagtctgcctcccagtcacaatcacatttgttgtctactgaagtggataaaaaagttgctaagtctgcaggcagtgcatcaggtaaatacacatctagcagcaaaaagttgttacacatagcagaggcagaaactgatgggaaaaatcagaaaaagacattgaggaaaggcaagacagctgtttctaatgatcaaaatccttcagtggtgaaactgaaattcaggaggggtaaggtaattgatctccagccagaaaccagcagccctaggaggctgacatttagattgggacgacatatgggtgaaagccaggacagtaatataagaaagagaaattttagaaagaaaggagttgatgatgacggaagtaatactatccctaactccagaaaaattgttttgaggcatcaggatgtgcaggaaaagaaagatgtgcagggtttgttgaataatgtgattgaagagacggcgagtaagcttgttgaaaccaggaaaagcaaggttaaagctttggtgggagcttttgagacagttatttccctccaagataaaccttctacagtaacagtttcttgattaacaaccataaatttctaacacataggagcaattgcaaatatagtggatgatataacttttctgacctggtttaagtatgtttgtcgtgtttctcattctgactcatcgtcttaacgatttcttgatggctttctggttctgttctcttgattgaataaattcagtttcatctggatgcacctacttggaattgagagattaagtcgcgtaagattgtgaactttttatcacttatggaggctgtgattgttgtgttagatcttagatcagtaggtgtttgcgtaatttctatgttgagctggttgctcagtgaacatatattgctgttgga

 

1631

 

LEFL2002CE03

2

ORF1

130

chr06_unfinished_C06HBa0177K13.1.v1.seq_C06HBa0177K13.1-11

2060

0

4076.0

AK247964

Show
LEFL2002CE03

LEFL2002CE03

 

2

 

ORF1

 

FF60D96EBCF79002

 

130

 

IPR011107

 

SEQUENCE: LEFL2002CE03_2_ORF1CRC64: FF60D96EBCF79002LENGTH: 130 aa
InterPro
IPR011107
Family
Protein phosphatase inhibitor
PFAMPF07491PPI_Ypi1
 2.6e-25 [47-97]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
PRODOMPD027623Q8S8F7_ARATH_Q8S8F7;
 2e-09 [44-80]T    
PANTHERPTHR20835FAMILY NOT NAMED
 3.5e-26 [3-97]T    
SEGsegseg
 NA [27-42]?  NA [81-101]?   
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr06_unfinished_C06HBa0177K13.1.v1.seq_C06HBa0177K13.1-11

 

99.95

 

2060

 

1

 

0

 

1

 

2060

 

1184

 

3243

 

0

 

4076.0

 

AK247964

 

cgggaaaatggccacaaggacgagggaaattgcacagccggcgaccgggacatcgacggtaaccttaaccctaggaaacccatcggaatctgcaccatcatcatcatcgtcacaacagcagcaaccaatcgaaaccctaactttgaaattgaagccgaagaggagagtgtcgtggaaagcaggaactgtggacaacgagttcctcaacaagaagagttccaagaaatgttgcattttccacaaagaaaagccttttgatgaagacgatagcgatgatgatgatgccgatgacaaagaaaatgacccatcaaagagtcatcatcatggggaccattgctgttctaaacaggatcatggaggagaagctagtacgagtttttcggaagatcactgatgtatttgacttgtaagtttgttgaactttttgttaagaaggaaaaaaatgttatttttggggtaaatttgttaattggtattatttgagatcttctgttgttgggaatctgattgaaatttatgtttcgatgacatgaagttgaacaattgatattagtgttacttcttatactattctgcttgtaagaaaaaaatttcatttttgaagtgaatttgagtatttggtatcattggagatgttttgggtttaaagttgctctgcattatacttgaattttgttaggttatcttggaagaacattgttccctttcttatccatgtttaagttttctgtgttctctgtataaacccgcataagcacctatttctaaatccgatgatatagaacaaaacaaagatgaaggatgccagaacaagtagatacctttttagtcattgtactaactggatcagagtgaagaatctgaatctattttaaacgagataaacataaaaggaggaaaaatcactccacaaatgaaattgctgaagcatttccctttgaactatttgaaagttatccaacttgaggtacgagggcatggagggttgtgtattgatgatggccatgaggagggtttgataggttgacagccggtgttaagataatttgattactcttcattaggatgtgtccattactctatttagcatgcagaaatggagttaaatagagtagaactgacgcaatttattcatatagttgacccttactaatataagattgagcaaatttggggtatgggggagaggtgttggtgcagttcatcaagcccgatctaacttttatataattagactatatcaagcttgtgtttcaagtccaggggattcaacccttgtatatcatgcattttattatttttggcttgtaatttacatgtataataagtaaatgttttgagcaaggggtatcatatgaatccccttgctttaatgtggttctgccactgtaggtgttctttgatagacgttttttttcttttcaaaaatggcaattgagaccagaaatattgttagtgaatctgcctatttagagttgatatctggacttgtatgatttcaagtgattctaatcttgttagcccgttatgtctcattacctttgttgtattaagcatcacaaagaggttgattaatctttggagctgaagcattgtcttggagtttgataagagaactgtgcgtccaagagattgaattttatgagtcactctttttaatgtgaagaactgctctaagcacatgccccgataagaaaggcaacaaaaagaagcaaagaaagaaaataaactagcggaaaattttgtgaatcaccaggatcattaaaccccaagctgtttgaaggattttacattttgtttccagcttgccaaaactctttcaattgaaccttcccctttttgctgtgtagagccataatattgctggtttgaatgtgcattatgaatgaagggtatcttgtgtttctcttgttttccttattactcggagattgaaagtttttctgtggtttgtgaaaacatgtatacgctacatgtaaatgtacttcaagtgaatttggttacatgttcaagatataatttgaaattctgaaagatggtatacgccttatttgattttc

 

4853

 

LEFL2002CE03

2

ORF1

130

chr06_unfinished_C06HBa0177K13.1.v1.seq_C06HBa0177K13.1-11

2060

0

4076.0

AK247964

Show
LEFL2002CE03

LEFL2002CE03

 

2

 

ORF1

 

FF60D96EBCF79002

 

130

 

IPR011107

 

SEQUENCE: LEFL2002CE03_2_ORF1CRC64: FF60D96EBCF79002LENGTH: 130 aa
InterPro
IPR011107
Family
Protein phosphatase inhibitor
PF07491[47-97]T 2.6e-25 PF07491 PPI_Ypi1PPI_Ypi1
noIPR
unintegrated
unintegrated
PD027623[44-80]T 2e-09 PD027623 Q8S8F7_ARATH_Q8S8F7;Q8S8F7_ARATH_Q8S8F7;
PTHR20835[3-97]T 3.5e-26 PTHR20835 FAMILY NOT NAMEDFAMILY NOT NAMED
seg[27-42]? NA seg seg[81-101]? NA seg segseg

 

chr06_unfinished_C06HBa0177K13.1.v1.seq_C06HBa0177K13.1-11

 

99.95

 

2060

 

1

 

0

 

1

 

2060

 

1184

 

3243

 

0

 

4076.0

 

AK247964

 

cgggaaaatggccacaaggacgagggaaattgcacagccggcgaccgggacatcgacggtaaccttaaccctaggaaacccatcggaatctgcaccatcatcatcatcgtcacaacagcagcaaccaatcgaaaccctaactttgaaattgaagccgaagaggagagtgtcgtggaaagcaggaactgtggacaacgagttcctcaacaagaagagttccaagaaatgttgcattttccacaaagaaaagccttttgatgaagacgatagcgatgatgatgatgccgatgacaaagaaaatgacccatcaaagagtcatcatcatggggaccattgctgttctaaacaggatcatggaggagaagctagtacgagtttttcggaagatcactgatgtatttgacttgtaagtttgttgaactttttgttaagaaggaaaaaaatgttatttttggggtaaatttgttaattggtattatttgagatcttctgttgttgggaatctgattgaaatttatgtttcgatgacatgaagttgaacaattgatattagtgttacttcttatactattctgcttgtaagaaaaaaatttcatttttgaagtgaatttgagtatttggtatcattggagatgttttgggtttaaagttgctctgcattatacttgaattttgttaggttatcttggaagaacattgttccctttcttatccatgtttaagttttctgtgttctctgtataaacccgcataagcacctatttctaaatccgatgatatagaacaaaacaaagatgaaggatgccagaacaagtagatacctttttagtcattgtactaactggatcagagtgaagaatctgaatctattttaaacgagataaacataaaaggaggaaaaatcactccacaaatgaaattgctgaagcatttccctttgaactatttgaaagttatccaacttgaggtacgagggcatggagggttgtgtattgatgatggccatgaggagggtttgataggttgacagccggtgttaagataatttgattactcttcattaggatgtgtccattactctatttagcatgcagaaatggagttaaatagagtagaactgacgcaatttattcatatagttgacccttactaatataagattgagcaaatttggggtatgggggagaggtgttggtgcagttcatcaagcccgatctaacttttatataattagactatatcaagcttgtgtttcaagtccaggggattcaacccttgtatatcatgcattttattatttttggcttgtaatttacatgtataataagtaaatgttttgagcaaggggtatcatatgaatccccttgctttaatgtggttctgccactgtaggtgttctttgatagacgttttttttcttttcaaaaatggcaattgagaccagaaatattgttagtgaatctgcctatttagagttgatatctggacttgtatgatttcaagtgattctaatcttgttagcccgttatgtctcattacctttgttgtattaagcatcacaaagaggttgattaatctttggagctgaagcattgtcttggagtttgataagagaactgtgcgtccaagagattgaattttatgagtcactctttttaatgtgaagaactgctctaagcacatgccccgataagaaaggcaacaaaaagaagcaaagaaagaaaataaactagcggaaaattttgtgaatcaccaggatcattaaaccccaagctgtttgaaggattttacattttgtttccagcttgccaaaactctttcaattgaaccttcccctttttgctgtgtagagccataatattgctggtttgaatgtgcattatgaatgaagggtatcttgtgtttctcttgttttccttattactcggagattgaaagtttttctgtggtttgtgaaaacatgtatacgctacatgtaaatgtacttcaagtgaatttggttacatgttcaagatataatttgaaattctgaaagatggtatacgccttatttgattttc

 

4852

 

LEFL2002CE03

2

ORF1

130

chr06_unfinished_C06HBa0177K13.1.v1.seq_C06HBa0177K13.1-11

2060

0

4076.0

AK247964

Show
LEFL2002CE03

LEFL2002CE03

 

2

 

ORF1

 

FF60D96EBCF79002

 

130

 

IPR011107

 

SEQUENCE: LEFL2002CE03_2_ORF1CRC64: FF60D96EBCF79002LENGTH: 130 aa
InterPro
IPR011107
Family
Protein phosphatase inhibitor
PF07491[47-97]T 2.6e-25 PF07491 PPI_Ypi1PPI_Ypi1
noIPR
unintegrated
unintegrated
PD027623[44-80]T 2e-09 PD027623 Q8S8F7_ARATH_Q8S8F7;Q8S8F7_ARATH_Q8S8F7;
PTHR20835[3-97]T 3.5e-26 PTHR20835 FAMILY NOT NAMEDFAMILY NOT NAMED
seg[27-42]? NA seg seg[81-101]? NA seg segseg

 

chr06_unfinished_C06HBa0177K13.1.v1.seq_C06HBa0177K13.1-11

 

99.95

 

2060

 

1

 

0

 

1

 

2060

 

1184

 

3243

 

0

 

4076.0

 

AK247964

 

cgggaaaatggccacaaggacgagggaaattgcacagccggcgaccgggacatcgacggtaaccttaaccctaggaaacccatcggaatctgcaccatcatcatcatcgtcacaacagcagcaaccaatcgaaaccctaactttgaaattgaagccgaagaggagagtgtcgtggaaagcaggaactgtggacaacgagttcctcaacaagaagagttccaagaaatgttgcattttccacaaagaaaagccttttgatgaagacgatagcgatgatgatgatgccgatgacaaagaaaatgacccatcaaagagtcatcatcatggggaccattgctgttctaaacaggatcatggaggagaagctagtacgagtttttcggaagatcactgatgtatttgacttgtaagtttgttgaactttttgttaagaaggaaaaaaatgttatttttggggtaaatttgttaattggtattatttgagatcttctgttgttgggaatctgattgaaatttatgtttcgatgacatgaagttgaacaattgatattagtgttacttcttatactattctgcttgtaagaaaaaaatttcatttttgaagtgaatttgagtatttggtatcattggagatgttttgggtttaaagttgctctgcattatacttgaattttgttaggttatcttggaagaacattgttccctttcttatccatgtttaagttttctgtgttctctgtataaacccgcataagcacctatttctaaatccgatgatatagaacaaaacaaagatgaaggatgccagaacaagtagatacctttttagtcattgtactaactggatcagagtgaagaatctgaatctattttaaacgagataaacataaaaggaggaaaaatcactccacaaatgaaattgctgaagcatttccctttgaactatttgaaagttatccaacttgaggtacgagggcatggagggttgtgtattgatgatggccatgaggagggtttgataggttgacagccggtgttaagataatttgattactcttcattaggatgtgtccattactctatttagcatgcagaaatggagttaaatagagtagaactgacgcaatttattcatatagttgacccttactaatataagattgagcaaatttggggtatgggggagaggtgttggtgcagttcatcaagcccgatctaacttttatataattagactatatcaagcttgtgtttcaagtccaggggattcaacccttgtatatcatgcattttattatttttggcttgtaatttacatgtataataagtaaatgttttgagcaaggggtatcatatgaatccccttgctttaatgtggttctgccactgtaggtgttctttgatagacgttttttttcttttcaaaaatggcaattgagaccagaaatattgttagtgaatctgcctatttagagttgatatctggacttgtatgatttcaagtgattctaatcttgttagcccgttatgtctcattacctttgttgtattaagcatcacaaagaggttgattaatctttggagctgaagcattgtcttggagtttgataagagaactgtgcgtccaagagattgaattttatgagtcactctttttaatgtgaagaactgctctaagcacatgccccgataagaaaggcaacaaaaagaagcaaagaaagaaaataaactagcggaaaattttgtgaatcaccaggatcattaaaccccaagctgtttgaaggattttacattttgtttccagcttgccaaaactctttcaattgaaccttcccctttttgctgtgtagagccataatattgctggtttgaatgtgcattatgaatgaagggtatcttgtgtttctcttgttttccttattactcggagattgaaagtttttctgtggtttgtgaaaacatgtatacgctacatgtaaatgtacttcaagtgaatttggttacatgttcaagatataatttgaaattctgaaagatggtatacgccttatttgattttc

 

4851

 

LEFL2047O21

2

ORF5

65

chr06_unfinished_C06HBa0054K13.1.v1.seq_C06HBa0054K13.1-4

1952

0

3870.0

AK247921

Show
LEFL2047O21

LEFL2047O21

 

2

 

ORF5

 

95EAC42ADFB71B99

 

65

 

IPR001764

 

SEQUENCE: LEFL2047O21_2_ORF5CRC64: 95EAC42ADFB71B99LENGTH: 65 aa
InterPro
IPR001764
Domain
Glycoside hydrolase, family 3, N-terminal
PS00775[19-36]? NA PS00775 GLYCOSYL_HYDROL_F3GLYCOSYL_HYDROL_F3

 

chr06_unfinished_C06HBa0054K13.1.v1.seq_C06HBa0054K13.1-4

 

100.0

 

1952

 

0

 

0

 

1

 

1952

 

3084

 

1133

 

0

 

3870.0

 

AK247921

 

ttcttcttcaactttaactttgtcgcatcaaatccttgttgaactcaactttggcttcttattcttatttgtctttgctgcaaaaatcttacgctttttgtcgcctcaagtaagttttccttaagcaagtagaaagtaaataaagacatatgttttccttaagcaaatacgatatagtattccttctttcacttggctttgaattccttcttacatctttattcacataatttttctactttaagtatgctaataaattacaaagttgtacttaatttttgatttttacttccagtaagctatgttaaatgaattcacgtttgctcaggttgctccaaaatgcatcgcaccggtttgttaatcttcaaaatatactcatacatattcatatgtacctaacaaattaacttttcatgaaaaatgaaggaagtattagaagaaaattgacatatttggagtgcatgaaaaaaaattaaaataaaatgaagacgaaagaaatcaattatataaaagtattaacaattcaagtttaaggccccgtttaatttttgttttaggccactaatatgtttgagccgacctgagtgaaaaatagtcctttgtgagaatcatccacacatattagtccatataaatattaatagcataattttttttctaaaaactgaaaatagtaacataaatatgagtgcaggtttacctgctacaaacatgttttcagtgtcattctctataaattatacatcctaatatactatacaacaataaatttcctcttgactctcctatgtgtatacatcaaacttcatagagctcctatatacaccaggtatcttacaaatgaaaattgagttacacatttaaggagtctcatgggaaaagaagaaacaaactatgttgtttgaactctcctaaaatatccctcggtgtttttgaagagtctgaacaatatagaaaacaagtgcatgttaactatccccttattagtctttagccttctctttacaatctcttttttcactatgtgtttcctttaatgctgcagaattacccttatctgaagtttgttcacttgcactaataggagtgactaaaatttcattcttgtcagttgaactggaagcaaaatttgtaacatcacttgtcttttcttgtttgttgttgttggtggtgttggaagacaccatagtggtcttgtttggtgattctacagagacttctttgaggctcattttaggtaagtcctccttcttgacatcattgtgattagtggcttcttcatgaaacttctcttcatcattggatggtttctgtataacgttgcaatcaaagacaaagtatgaatttcgttaaggatgttctagattcaacatacacgtatagtttattatatatgcggtttatttttcctggcaaaggatgttcaactaaccaccgttgagcctatgtgactccgtattacattattttcacaagcacaaaaatatgatataatgaatgtaacaagaaaagaccatctatttatgctgtttcaaagagagggtaagttttatgtactgataagtgcgaaaataggagaacctattctctaaagggtggtttggtttatcatactaacaaaaataatcctaccatactgtcagtatatataacttaagtaattgaaggtatcatttgatccagtctatataaacgtaccgttttagcatctgtatgatgaagttggtctgatgcagactcaactaatgaagttctagacattcttggacttggactttcacctatttgttcctccctgtcaaagttcaacagagggccttgacctgttgaggactttggtttgagtacggactttggtgatgatgaacaactcgaggctgtagggacttctcggattaaagattgtaagctgatcaagtcttgattgacagagctctccgatggaattccagaagtcgaggagccttcacttgctgagaactttggttgaatcatagtgttgggagagggggatgaagtagaggccctcggaacttgttcaaccaccaaatcatgtggtgatgatgatgatgatgcttgtgaaccatcaatactctggctaattgtagaaaaaacttcttcaataggctgtttaccaccattatcgtgaagtgcttcatgaatttcattcctagggagagactttgaattttctgcagacttctgtgtcttcggatgtggtactgaactttgcactgtcggatttcttaacgtaagttttgagctccgagtactggttggatcacaactttcagcagttacttcatctgtcagcttattttttagtttgcgcctatctacttgttgagcctccaaatttgaactagatcctttatcaatggaaaatgttggttgcgaaacagacttagacgatgatgtactagaagaggcttcaaatgagtgatgtccttgtccaatagtcgaaaatgccacaggttcactatgttgttcgctggcactgtctagaacgagtgcagcgacatcgttctctttggctgaaattgaattttctgtttctgaaggtaattcagaaacttgtaatgttaagttgcttaaactaagatctgattcctgtgaagcaattgaatctgatctttcactagatatgttcactgacctatcattttgtagctgatcaatactcgaagaggatccatgttcaatcaaacaatttggttgtagaacagatgtcggtgatactaatgacgttaatgcgaaagggagttgttgtgctggaaattctggctgtagtaatgaaccttgaaatctttcaccgactacagaaagtccttccggcctacgctgttgataactactgctagcttgattcctgtctgtccttggaggtggaaatgagcttgaaccagtggaatacggttcgattgttcgttctgatggaatattttgtggcacattattctcagacatatggaacctcgaaaatccaaattctactatatcttgttcagtgacctcgcatacttctctggaatttgattcattttcatctactctagctaggtgagatgaagacatcagaacgtcctcactgctagacgttatagctttttctatctccccatctatagagatctcctcacccacggatgagttcccatcgtctgtcaagggaggtgaaccaacttcagaaacctccacttgcaagtcagaagcaatagactggccgggagtgtgatgcataggacgattaggatagtataaacgttcgttctctatcgtgttctccaacaaggataaaccagaaggcgatggatcacctgataagttccttagagcaggagaagcaatagacttcaagattgcatctttgtctatcttatagattggttcatcatcttccgacgaagatgatgaacttaccctattgctaatatcttccactagtactgactttatctgtacttcactactgtctttttcatcc

 

4602