SEQID Frame ORF Length TargetID Aln_Length E-value Score Accession

FC17DD06

2

ORF1

254

chr08_finished_C08HBa0235H18.1.v2.seq_C08HBa0235H18.1

444

9E-91

333.0

AK246641

Show
FC17DD06

FC17DD06

 

2

 

ORF1

 

BD08E17EA357EDC2

 

254

 

IPR001938

 

SEQUENCE: FC17DD06_2_ORF1CRC64: BD08E17EA357EDC2LENGTH: 254 aa
InterPro
IPR001938
Family
Thaumatin, pathogenesis-related
PD001321[34-233]T 3e-130 PD001321 Q7Y1P9_LYCES_Q7Y1P9;Q7Y1P9_LYCES_Q7Y1P9;
PR00347[28-40]T 1.3e-43 PR00347 THAUMATIN[48-57]T 1.3e-43 PR00347 THAUMATIN[70-81]T 1.3e-43 PR00347 THAUMATIN[83-112]T 1.3e-43 PR00347 THAUMATIN[120-136]T 1.3e-43 PR00347 THAUMATIN[221-230]T 1.3e-43 PR00347 THAUMATINTHAUMATIN
PF00314[33-231]T 3.1e-131 PF00314 ThaumatinThaumatin
SM00205[29-231]T 2.7e-151 SM00205 no descriptionno description
PS00316[83-98]T 8e-5 PS00316 THAUMATINTHAUMATIN
noIPR
unintegrated
unintegrated
G3D.2.60.110.10[27-233]T 2.9e-87 G3D.2.60.110.10 no descriptionno description
SSF49870[26-231]T 1.5e-92 SSF49870 Osmotin, thaumatin-like proteinOsmotin, thaumatin-like protein

 

chr08_finished_C08HBa0235H18.1.v2.seq_C08HBa0235H18.1

 

84.46

 

444

 

69

 

0

 

193

 

636

 

41447

 

41004

 

9E-91

 

333.0

 

AK246641

 

cttttattctaaaatgagtcatttgacaacttgtttagtgttctttctccttgcctttgtgacttacacttatgcttccggtgtatttgaggtccataacaactgtccatacaccgtatgggcagcggcgactcccgtaggaggtggccgacgtctcgagagaggtcaaagttggtggttttgggctccaccgggcaccaaaatggcacgtatttggggtcgtactaattgcaattttgatggtgctggtagaggttggtgccagaccggtgattgtggtggagtcttggaatgcaaaggatggggtaaaccaccaaacaccttagctgaatacgctttgaatcaatttagcaacttaaatttctgggacatttctgttattgatggattcaacatccctatgtctttcggcccaactaaccctgggccgggaaaatgtcatccaattcaatgtgttgctaatataaacggtgaatgccctggttcacttagggtacccggaggatgtaacaacccttgtactacattcggaggacaacaatattgttgcactcaaggtccatgtggtcctaccgatttgtcaagatttttcaaacaaagatgtcccgatgcctatagttatcctcaagacgatccaacaagtacttttacttgtcagagttggactacagactacaaggttatgttttgtccttatggctctactcacaatgaaacaacaaatttcccattggagattcctacaaatactcttgaagtggcttaattaagtagaaatcttgagttgagccaatctcttttttgttaaatttgttttgaagatggacattgtctttaatttgccttgtacacatttcttttacatttgtttgtttgaagtggctaagatctgaataacaatctatgatcgatgctttgtcttaaaaaaaaaaaa

 

1156

 

LEFL2017I19

2

ORF3

78

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF3

 

6433F915C5B41EDA

 

78

 

IPR000152

 

SEQUENCE: LEFL2017I19_2_ORF3CRC64: 6433F915C5B41EDALENGTH: 78 aa
InterPro
IPR000152
PTM
Aspartic acid and asparagine hydroxylation site
PS00010[9-20]? NA PS00010 ASX_HYDROXYLASX_HYDROXYL
noIPR
unintegrated
unintegrated
G3D.3.30.70.270[19-78]T 5.1e-09 G3D.3.30.70.270 no descriptionno description
PTHR10178[28-78]T 9.9e-19 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF14[28-78]T 9.9e-19 PTHR10178:SF14 RETROVIRUS POLYPROTEINRETROVIRUS POLYPROTEIN
SSF56672[19-78]T 2.4e-10 SSF56672 DNA/RNA polymerasesDNA/RNA polymerases

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5395

 

LEFL2017I19

2

ORF2

235

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF2

 

164EB2CDA2E3381E

 

235

 

IPR005162

 

SEQUENCE: LEFL2017I19_2_ORF2CRC64: 164EB2CDA2E3381ELENGTH: 235 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PFAMPF03732Retrotrans_gag
 6.6e-25 [95-193]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 9.6e-15 [53-218]T    
PANTHERPTHR10178:SF12POLYPROTEIN-RELATED
 9.6e-15 [53-218]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5397

 

LEFL2017I19

3

ORF2

132

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

3

 

ORF2

 

893646D52CDB26C6

 

132

 

IPR000477

 

SEQUENCE: LEFL2017I19_3_ORF2CRC64: 893646D52CDB26C6LENGTH: 132 aa
InterPro
IPR000477
Domain
RNA-directed DNA polymerase (Reverse transcriptase)
PF00078[18-128]T 1.2e-26 PF00078 RVT_1RVT_1
noIPR
unintegrated
unintegrated
G3D.3.10.10.10[1-113]T 2.3e-30 G3D.3.10.10.10 no descriptionno description
PTHR10178[1-126]T 3.4e-79 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF14[1-126]T 3.4e-79 PTHR10178:SF14 RETROVIRUS POLYPROTEINRETROVIRUS POLYPROTEIN
SSF56672[1-128]T 4.6e-44 SSF56672 DNA/RNA polymerasesDNA/RNA polymerases

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5396

 

LEFL2017I19

3

ORF2

132

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

3

 

ORF2

 

893646D52CDB26C6

 

132

 

IPR000477

 

SEQUENCE: LEFL2017I19_3_ORF2CRC64: 893646D52CDB26C6LENGTH: 132 aa
InterPro
IPR000477
Domain
RNA-directed DNA polymerase (Reverse transcriptase)
PF00078[18-128]T 1.2e-26 PF00078 RVT_1RVT_1
noIPR
unintegrated
unintegrated
G3D.3.10.10.10[1-113]T 2.3e-30 G3D.3.10.10.10 no descriptionno description
PTHR10178[1-126]T 3.4e-79 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF14[1-126]T 3.4e-79 PTHR10178:SF14 RETROVIRUS POLYPROTEINRETROVIRUS POLYPROTEIN
SSF56672[1-128]T 4.6e-44 SSF56672 DNA/RNA polymerasesDNA/RNA polymerases

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5393

 

LEFL2017I19

2

ORF2

235

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF2

 

164EB2CDA2E3381E

 

235

 

IPR005162

 

SEQUENCE: LEFL2017I19_2_ORF2CRC64: 164EB2CDA2E3381ELENGTH: 235 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[95-193]T 6.6e-25 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[53-218]T 9.6e-15 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[53-218]T 9.6e-15 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5394

 

LEFL2017I19

2

ORF3

78

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF3

 

6433F915C5B41EDA

 

78

 

IPR000152

 

SEQUENCE: LEFL2017I19_2_ORF3CRC64: 6433F915C5B41EDALENGTH: 78 aa
InterPro
IPR000152
PTM
Aspartic acid and asparagine hydroxylation site
PROSITEPS00010ASX_HYDROXYL
 NA [9-20]?    
Parentno parent
Childrenno children
Found inIPR000742IPR001438IPR001491IPR001881IPR003056IPR006209IPR006210IPR008297IPR011361IPR011398IPR013091
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
GENE3DG3D.3.30.70.270no description
 5.1e-09 [19-78]T    
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 9.9e-19 [28-78]T    
PANTHERPTHR10178:SF14RETROVIRUS POLYPROTEIN
 9.9e-19 [28-78]T    
SUPERFAMILYSSF56672DNA/RNA polymerases
 2.4e-10 [19-78]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5398

 

LEFL2017I19

2

ORF2

235

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF2

 

164EB2CDA2E3381E

 

235

 

IPR005162

 

SEQUENCE: LEFL2017I19_2_ORF2CRC64: 164EB2CDA2E3381ELENGTH: 235 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[95-193]T 6.6e-25 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[53-218]T 9.6e-15 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[53-218]T 9.6e-15 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5391

 

LEFL2017I19

2

ORF3

78

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF3

 

6433F915C5B41EDA

 

78

 

IPR000152

 

SEQUENCE: LEFL2017I19_2_ORF3CRC64: 6433F915C5B41EDALENGTH: 78 aa
InterPro
IPR000152
PTM
Aspartic acid and asparagine hydroxylation site
PS00010[9-20]? NA PS00010 ASX_HYDROXYLASX_HYDROXYL
noIPR
unintegrated
unintegrated
G3D.3.30.70.270[19-78]T 5.1e-09 G3D.3.30.70.270 no descriptionno description
PTHR10178[28-78]T 9.9e-19 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF14[28-78]T 9.9e-19 PTHR10178:SF14 RETROVIRUS POLYPROTEINRETROVIRUS POLYPROTEIN
SSF56672[19-78]T 2.4e-10 SSF56672 DNA/RNA polymerasesDNA/RNA polymerases

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5392

 

LEFL2017I19

3

ORF2

132

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

313

9E-89

327.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

3

 

ORF2

 

893646D52CDB26C6

 

132

 

IPR000477

 

SEQUENCE: LEFL2017I19_3_ORF2CRC64: 893646D52CDB26C6LENGTH: 132 aa
InterPro
IPR000477
Domain
RNA-directed DNA polymerase (Reverse transcriptase)
PFAMPF00078RVT_1
 1.2e-26 [18-128]T    
Parentno parent
Childrenno children
Found inIPR000123IPR003286IPR003545
Containsno entries
GO termsMolecular Function: RNA binding (GO:0003723)
Molecular Function: RNA-directed DNA polymerase activity (GO:0003964)
Biological Process: RNA-dependent DNA replication (GO:0006278)
noIPR
unintegrated
unintegrated
GENE3DG3D.3.10.10.10no description
 2.3e-30 [1-113]T    
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 3.4e-79 [1-126]T    
PANTHERPTHR10178:SF14RETROVIRUS POLYPROTEIN
 3.4e-79 [1-126]T    
SUPERFAMILYSSF56672DNA/RNA polymerases
 4.6e-44 [1-128]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr02_finished_C02HBa0323C04.1.v1.seq_C02HBa0323C04.1

 

88.5

 

313

 

35

 

1

 

2

 

314

 

13474

 

13163

 

9E-89

 

327.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5399

 

LEFL1004DA08

2

ORF2

218

chr09_finished_C09HBa0109D11.1.v1.seq_C09HBa0109D11.1

283

9E-88

323.0

AK247358

Show
LEFL1004DA08

LEFL1004DA08

 

2

 

ORF2

 

7FC6A1833395CA5C

 

218

 

IPR001806 | IPR002041 | IPR003577 | IPR003578 | IPR003579 | IPR005225 | IPR013753

 

SEQUENCE: LEFL1004DA08_2_ORF2CRC64: 7FC6A1833395CA5CLENGTH: 218 aa
InterPro
IPR001806
Family
Ras GTPase
PR00449[15-36]T 5.4e-41 PR00449 RASTRNSFRMNG[38-54]T 5.4e-41 PR00449 RASTRNSFRMNG[56-78]T 5.4e-41 PR00449 RASTRNSFRMNG[118-131]T 5.4e-41 PR00449 RASTRNSFRMNG[153-175]T 5.4e-41 PR00449 RASTRNSFRMNGRASTRNSFRMNG
InterPro
IPR002041
Family
GTP-binding nuclear protein Ran
SM00176[20-209]T 1.4e-05 SM00176 no descriptionno description
InterPro
IPR003577
Family
Ras small GTPase, Ras type
SM00173[12-178]T 7.8e-26 SM00173 no descriptionno description
InterPro
IPR003578
Family
Ras small GTPase, Rho type
SM00174[17-178]T 8.8e-13 SM00174 no descriptionno description
InterPro
IPR003579
Family
Ras small GTPase, Rab type
SM00175[15-178]T 5.6e-104 SM00175 no descriptionno description
InterPro
IPR005225
Domain
Small GTP-binding protein domain
TIGR00231[12-173]T 6.4e-35 TIGR00231 small_GTP: small GTP-binding protein domainsmall_GTP: small GTP-binding protein domain
InterPro
IPR013753
Family
Ras
PF00071[16-177]T 1e-93 PF00071 RasRas
noIPR
unintegrated
unintegrated
G3D.3.40.50.300[10-183]T 1.8e-54 G3D.3.40.50.300 no descriptionno description
PTHR11708[5-125]T 1.5e-80 PTHR11708 RAS-RELATED GTPASERAS-RELATED GTPASE
PTHR11708:SF213[5-125]T 1.5e-80 PTHR11708:SF213 RAB11RAB11
seg[140-151]? NA seg segseg
SSF52540[9-175]T 5.3e-44 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr09_finished_C09HBa0109D11.1.v1.seq_C09HBa0109D11.1

 

89.4

 

283

 

30

 

0

 

84

 

366

 

8722

 

8440

 

9E-88

 

323.0

 

AK247358

 

aattttctcccacaacccatcttccattttctctcaacatcccaaaaaaaaaaaaaaatctactaaaaaaaagttttgacttgaaatggattcatcagatgatgatgttgaagagtaccttttcaagattgtaataataggggattcagcagttggtaaatcaaatttgttgtcaagatatgcaagggatgagtttaatttgcattctaaagctactattggagttgaatttcagacccaagttcttgaaattaatgggaaagaagttaaagctcagatttgggatactgctggacaagaaaggtttagagctgtgacttctgcttattatcgtggtgcttttggtgcactccttgtgtatgatataagtcggaggagtacttttgaaagtgttactagatggcttgatgagctcaatacccattgtgatacaacagtcgcgaagatgctggtaggaaacaaatgtgatttggacaacattagagacgttagtattgaagaaggcgcgaagcttgcagaagcagaaggattgttcttcatggagacatccgcgttggattctacaaacgttaataaggctttcgagattgttatccgtgaaatctatagcaatgtcagtcgaaaggtcttgaattcggattcctacaaggcagagttatctattaacagggtaaaccttgtaaaagacgacggagaaggatcgaaacgatcttggagcagttgttgctcaagatgaaccatgtcttaactggttatacattttgttattgttagctcaagattaagagatttttcagtattcattcaattcagtaacacagtgaattgtataaatctctcttaactctgattgagcatatgtattctcacttttaagttttattactcttaaacgataaattgtttgattcgatgtaaacatcaggtacgaggaactattttttatggagacatatttatttttagc

 

1946

 

LEFL2002CC11

3

ORF2

218

chr09_unfinished_C09HBa0059I05.1.v1.seq_C09HBa0059I05.1-3

283

9E-88

323.0

AK247962

Show
LEFL2002CC11

LEFL2002CC11

 

3

 

ORF2

 

7FC6A1833395CA5C

 

218

 

IPR001806 | IPR002041 | IPR003577 | IPR003578 | IPR003579 | IPR005225 | IPR013753

 

SEQUENCE: LEFL2002CC11_3_ORF2CRC64: 7FC6A1833395CA5CLENGTH: 218 aa
InterPro
IPR001806
Family
Ras GTPase
PR00449[15-36]T 5.4e-41 PR00449 RASTRNSFRMNG[38-54]T 5.4e-41 PR00449 RASTRNSFRMNG[56-78]T 5.4e-41 PR00449 RASTRNSFRMNG[118-131]T 5.4e-41 PR00449 RASTRNSFRMNG[153-175]T 5.4e-41 PR00449 RASTRNSFRMNGRASTRNSFRMNG
InterPro
IPR002041
Family
GTP-binding nuclear protein Ran
SM00176[20-209]T 1.4e-05 SM00176 no descriptionno description
InterPro
IPR003577
Family
Ras small GTPase, Ras type
SM00173[12-178]T 7.8e-26 SM00173 no descriptionno description
InterPro
IPR003578
Family
Ras small GTPase, Rho type
SM00174[17-178]T 8.8e-13 SM00174 no descriptionno description
InterPro
IPR003579
Family
Ras small GTPase, Rab type
SM00175[15-178]T 5.6e-104 SM00175 no descriptionno description
InterPro
IPR005225
Domain
Small GTP-binding protein domain
TIGR00231[12-173]T 6.4e-35 TIGR00231 small_GTP: small GTP-binding protein domainsmall_GTP: small GTP-binding protein domain
InterPro
IPR013753
Family
Ras
PF00071[16-177]T 1e-93 PF00071 RasRas
noIPR
unintegrated
unintegrated
G3D.3.40.50.300[10-183]T 1.8e-54 G3D.3.40.50.300 no descriptionno description
PTHR11708[5-125]T 1.5e-80 PTHR11708 RAS-RELATED GTPASERAS-RELATED GTPASE
PTHR11708:SF213[5-125]T 1.5e-80 PTHR11708:SF213 RAB11RAB11
seg[140-151]? NA seg segseg
SSF52540[9-175]T 5.3e-44 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr09_unfinished_C09HBa0059I05.1.v1.seq_C09HBa0059I05.1-3

 

89.4

 

283

 

30

 

0

 

133

 

415

 

8216

 

7934

 

9E-88

 

323.0

 

AK247962

 

atagctcaaggtccactcgttatcaattctcctttttttttttttttttaattttctcccacaacccatcttccattttctctcaacatcccaaaaaaaaaaaaaaatctactaaaaaaaagttttgacttgaaatggattcatcagatgatgatgttgaagagtaccttttcaagattgtaataataggggattcagcagttggtaaatcaaatttgttgtcaagatatgcaagggatgagtttaatttgcattctaaagctactattggagttgaatttcagacccaagttcttgaaattaatgggaaagaagttaaagctcagatttgggatactgctggacaagaaaggtttagagctgtgacttctgcttattatcgtggtgcttttggtgcactccttgtgtatgatataagtcggaggagtacttttgaaagtgttactagatggcttgatgagctcaatacccattgtgatacaacagtcgcgaagatgctggtaggaaacaaatgtgatttggacaacattagagacgttagtattgaagaaggcgcgaagcttgcagaagcagaaggattgttcttcatggagacatccgcgttggattctacaaacgttaataaggctttcgagattgttatccgtgaaatctatagcaatgtcagtcgaaaggtcttgaattcggattcctacaaggcagagttatctattaacagggtaaaccttgtaaaagacgacggagaaggatcgaaacgatcttggagcagttgttgctcaagatgaaccatgtcttaactggttatacattttgttattgttagctcaagattaagagatttttcagtattcattcaattcagtaacacagtgaattgtataaatctctcttaactctgattgagcatatgtattctcacttttaagttttattactcttaaacgataaattgtttgattcgatgtaaacatcaggtacgaggaactattttttatggagacatatttatttttagc

 

4837

 

LEFL1004DA08

2

ORF2

218

chr09_unfinished_C09HBa0059I05.1.v1.seq_C09HBa0059I05.1-3

283

9E-88

323.0

AK247358

Show
LEFL1004DA08

LEFL1004DA08

 

2

 

ORF2

 

7FC6A1833395CA5C

 

218

 

IPR001806 | IPR002041 | IPR003577 | IPR003578 | IPR003579 | IPR005225 | IPR013753

 

SEQUENCE: LEFL1004DA08_2_ORF2CRC64: 7FC6A1833395CA5CLENGTH: 218 aa
InterPro
IPR001806
Family
Ras GTPase
PR00449[15-36]T 5.4e-41 PR00449 RASTRNSFRMNG[38-54]T 5.4e-41 PR00449 RASTRNSFRMNG[56-78]T 5.4e-41 PR00449 RASTRNSFRMNG[118-131]T 5.4e-41 PR00449 RASTRNSFRMNG[153-175]T 5.4e-41 PR00449 RASTRNSFRMNGRASTRNSFRMNG
InterPro
IPR002041
Family
GTP-binding nuclear protein Ran
SM00176[20-209]T 1.4e-05 SM00176 no descriptionno description
InterPro
IPR003577
Family
Ras small GTPase, Ras type
SM00173[12-178]T 7.8e-26 SM00173 no descriptionno description
InterPro
IPR003578
Family
Ras small GTPase, Rho type
SM00174[17-178]T 8.8e-13 SM00174 no descriptionno description
InterPro
IPR003579
Family
Ras small GTPase, Rab type
SM00175[15-178]T 5.6e-104 SM00175 no descriptionno description
InterPro
IPR005225
Domain
Small GTP-binding protein domain
TIGR00231[12-173]T 6.4e-35 TIGR00231 small_GTP: small GTP-binding protein domainsmall_GTP: small GTP-binding protein domain
InterPro
IPR013753
Family
Ras
PF00071[16-177]T 1e-93 PF00071 RasRas
noIPR
unintegrated
unintegrated
G3D.3.40.50.300[10-183]T 1.8e-54 G3D.3.40.50.300 no descriptionno description
PTHR11708[5-125]T 1.5e-80 PTHR11708 RAS-RELATED GTPASERAS-RELATED GTPASE
PTHR11708:SF213[5-125]T 1.5e-80 PTHR11708:SF213 RAB11RAB11
seg[140-151]? NA seg segseg
SSF52540[9-175]T 5.3e-44 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr09_unfinished_C09HBa0059I05.1.v1.seq_C09HBa0059I05.1-3

 

89.4

 

283

 

30

 

0

 

84

 

366

 

8216

 

7934

 

9E-88

 

323.0

 

AK247358

 

aattttctcccacaacccatcttccattttctctcaacatcccaaaaaaaaaaaaaaatctactaaaaaaaagttttgacttgaaatggattcatcagatgatgatgttgaagagtaccttttcaagattgtaataataggggattcagcagttggtaaatcaaatttgttgtcaagatatgcaagggatgagtttaatttgcattctaaagctactattggagttgaatttcagacccaagttcttgaaattaatgggaaagaagttaaagctcagatttgggatactgctggacaagaaaggtttagagctgtgacttctgcttattatcgtggtgcttttggtgcactccttgtgtatgatataagtcggaggagtacttttgaaagtgttactagatggcttgatgagctcaatacccattgtgatacaacagtcgcgaagatgctggtaggaaacaaatgtgatttggacaacattagagacgttagtattgaagaaggcgcgaagcttgcagaagcagaaggattgttcttcatggagacatccgcgttggattctacaaacgttaataaggctttcgagattgttatccgtgaaatctatagcaatgtcagtcgaaaggtcttgaattcggattcctacaaggcagagttatctattaacagggtaaaccttgtaaaagacgacggagaaggatcgaaacgatcttggagcagttgttgctcaagatgaaccatgtcttaactggttatacattttgttattgttagctcaagattaagagatttttcagtattcattcaattcagtaacacagtgaattgtataaatctctcttaactctgattgagcatatgtattctcacttttaagttttattactcttaaacgataaattgtttgattcgatgtaaacatcaggtacgaggaactattttttatggagacatatttatttttagc

 

1942

 

LEFL2002CC11

3

ORF2

218

chr09_finished_C09HBa0109D11.1.v1.seq_C09HBa0109D11.1

283

9E-88

323.0

AK247962

Show
LEFL2002CC11

LEFL2002CC11

 

3

 

ORF2

 

7FC6A1833395CA5C

 

218

 

IPR001806 | IPR002041 | IPR003577 | IPR003578 | IPR003579 | IPR005225 | IPR013753

 

SEQUENCE: LEFL2002CC11_3_ORF2CRC64: 7FC6A1833395CA5CLENGTH: 218 aa
InterPro
IPR001806
Family
Ras GTPase
PR00449[15-36]T 5.4e-41 PR00449 RASTRNSFRMNG[38-54]T 5.4e-41 PR00449 RASTRNSFRMNG[56-78]T 5.4e-41 PR00449 RASTRNSFRMNG[118-131]T 5.4e-41 PR00449 RASTRNSFRMNG[153-175]T 5.4e-41 PR00449 RASTRNSFRMNGRASTRNSFRMNG
InterPro
IPR002041
Family
GTP-binding nuclear protein Ran
SM00176[20-209]T 1.4e-05 SM00176 no descriptionno description
InterPro
IPR003577
Family
Ras small GTPase, Ras type
SM00173[12-178]T 7.8e-26 SM00173 no descriptionno description
InterPro
IPR003578
Family
Ras small GTPase, Rho type
SM00174[17-178]T 8.8e-13 SM00174 no descriptionno description
InterPro
IPR003579
Family
Ras small GTPase, Rab type
SM00175[15-178]T 5.6e-104 SM00175 no descriptionno description
InterPro
IPR005225
Domain
Small GTP-binding protein domain
TIGR00231[12-173]T 6.4e-35 TIGR00231 small_GTP: small GTP-binding protein domainsmall_GTP: small GTP-binding protein domain
InterPro
IPR013753
Family
Ras
PF00071[16-177]T 1e-93 PF00071 RasRas
noIPR
unintegrated
unintegrated
G3D.3.40.50.300[10-183]T 1.8e-54 G3D.3.40.50.300 no descriptionno description
PTHR11708[5-125]T 1.5e-80 PTHR11708 RAS-RELATED GTPASERAS-RELATED GTPASE
PTHR11708:SF213[5-125]T 1.5e-80 PTHR11708:SF213 RAB11RAB11
seg[140-151]? NA seg segseg
SSF52540[9-175]T 5.3e-44 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr09_finished_C09HBa0109D11.1.v1.seq_C09HBa0109D11.1

 

89.4

 

283

 

30

 

0

 

133

 

415

 

8722

 

8440

 

9E-88

 

323.0

 

AK247962

 

atagctcaaggtccactcgttatcaattctcctttttttttttttttttaattttctcccacaacccatcttccattttctctcaacatcccaaaaaaaaaaaaaaatctactaaaaaaaagttttgacttgaaatggattcatcagatgatgatgttgaagagtaccttttcaagattgtaataataggggattcagcagttggtaaatcaaatttgttgtcaagatatgcaagggatgagtttaatttgcattctaaagctactattggagttgaatttcagacccaagttcttgaaattaatgggaaagaagttaaagctcagatttgggatactgctggacaagaaaggtttagagctgtgacttctgcttattatcgtggtgcttttggtgcactccttgtgtatgatataagtcggaggagtacttttgaaagtgttactagatggcttgatgagctcaatacccattgtgatacaacagtcgcgaagatgctggtaggaaacaaatgtgatttggacaacattagagacgttagtattgaagaaggcgcgaagcttgcagaagcagaaggattgttcttcatggagacatccgcgttggattctacaaacgttaataaggctttcgagattgttatccgtgaaatctatagcaatgtcagtcgaaaggtcttgaattcggattcctacaaggcagagttatctattaacagggtaaaccttgtaaaagacgacggagaaggatcgaaacgatcttggagcagttgttgctcaagatgaaccatgtcttaactggttatacattttgttattgttagctcaagattaagagatttttcagtattcattcaattcagtaacacagtgaattgtataaatctctcttaactctgattgagcatatgtattctcacttttaagttttattactcttaaacgataaattgtttgattcgatgtaaacatcaggtacgaggaactattttttatggagacatatttatttttagc

 

4843

 

LEFL1004DA08

2

ORF2

218

chr09_finished_C09HBa0109D11.1.v1.seq_C09HBa0109D11.1

283

9E-88

323.0

AK247358

Show
LEFL1004DA08

LEFL1004DA08

 

2

 

ORF2

 

7FC6A1833395CA5C

 

218

 

IPR001806 | IPR002041 | IPR003577 | IPR003578 | IPR003579 | IPR005225 | IPR013753

 

SEQUENCE: LEFL1004DA08_2_ORF2CRC64: 7FC6A1833395CA5CLENGTH: 218 aa
InterPro
IPR001806
Family
Ras GTPase
PR00449[15-36]T 5.4e-41 PR00449 RASTRNSFRMNG[38-54]T 5.4e-41 PR00449 RASTRNSFRMNG[56-78]T 5.4e-41 PR00449 RASTRNSFRMNG[118-131]T 5.4e-41 PR00449 RASTRNSFRMNG[153-175]T 5.4e-41 PR00449 RASTRNSFRMNGRASTRNSFRMNG
InterPro
IPR002041
Family
GTP-binding nuclear protein Ran
SM00176[20-209]T 1.4e-05 SM00176 no descriptionno description
InterPro
IPR003577
Family
Ras small GTPase, Ras type
SM00173[12-178]T 7.8e-26 SM00173 no descriptionno description
InterPro
IPR003578
Family
Ras small GTPase, Rho type
SM00174[17-178]T 8.8e-13 SM00174 no descriptionno description
InterPro
IPR003579
Family
Ras small GTPase, Rab type
SM00175[15-178]T 5.6e-104 SM00175 no descriptionno description
InterPro
IPR005225
Domain
Small GTP-binding protein domain
TIGR00231[12-173]T 6.4e-35 TIGR00231 small_GTP: small GTP-binding protein domainsmall_GTP: small GTP-binding protein domain
InterPro
IPR013753
Family
Ras
PF00071[16-177]T 1e-93 PF00071 RasRas
noIPR
unintegrated
unintegrated
G3D.3.40.50.300[10-183]T 1.8e-54 G3D.3.40.50.300 no descriptionno description
PTHR11708[5-125]T 1.5e-80 PTHR11708 RAS-RELATED GTPASERAS-RELATED GTPASE
PTHR11708:SF213[5-125]T 1.5e-80 PTHR11708:SF213 RAB11RAB11
seg[140-151]? NA seg segseg
SSF52540[9-175]T 5.3e-44 SSF52540 P-loop containing nucleoside triphosphate hydrolasesP-loop containing nucleoside triphosphate hydrolases

 

chr09_finished_C09HBa0109D11.1.v1.seq_C09HBa0109D11.1

 

89.4

 

283

 

30

 

0

 

84

 

366

 

8722

 

8440

 

9E-88

 

323.0

 

AK247358

 

aattttctcccacaacccatcttccattttctctcaacatcccaaaaaaaaaaaaaaatctactaaaaaaaagttttgacttgaaatggattcatcagatgatgatgttgaagagtaccttttcaagattgtaataataggggattcagcagttggtaaatcaaatttgttgtcaagatatgcaagggatgagtttaatttgcattctaaagctactattggagttgaatttcagacccaagttcttgaaattaatgggaaagaagttaaagctcagatttgggatactgctggacaagaaaggtttagagctgtgacttctgcttattatcgtggtgcttttggtgcactccttgtgtatgatataagtcggaggagtacttttgaaagtgttactagatggcttgatgagctcaatacccattgtgatacaacagtcgcgaagatgctggtaggaaacaaatgtgatttggacaacattagagacgttagtattgaagaaggcgcgaagcttgcagaagcagaaggattgttcttcatggagacatccgcgttggattctacaaacgttaataaggctttcgagattgttatccgtgaaatctatagcaatgtcagtcgaaaggtcttgaattcggattcctacaaggcagagttatctattaacagggtaaaccttgtaaaagacgacggagaaggatcgaaacgatcttggagcagttgttgctcaagatgaaccatgtcttaactggttatacattttgttattgttagctcaagattaagagatttttcagtattcattcaattcagtaacacagtgaattgtataaatctctcttaactctgattgagcatatgtattctcacttttaagttttattactcttaaacgataaattgtttgattcgatgtaaacatcaggtacgaggaactattttttatggagacatatttatttttagc

 

1945