SEQID Frame ORF Length TargetID Aln_Length E-value Score Accession

LEFL2052M19

3

ORF3

321

chr08_finished_C08HBa0323O07.1.v1.seq_C08HBa0323O07.1

895

0

1076.0

AK248072

Show
LEFL2052M19

LEFL2052M19

 

3

 

ORF3

 

EA2FB960723E27D1

 

321

 

IPR001878 | IPR005162

 

SEQUENCE: LEFL2052M19_3_ORF3CRC64: EA2FB960723E27D1LENGTH: 321 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[298-307]T 0.18 PR00939 C2HCZNFINGER[307-315]T 0.18 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[298-315]T 5.8e-06 PF00098 zf-CCHCzf-CCHC
SM00343[299-315]T 0.00044 SM00343 no descriptionno description
PS50158[300-315]T 10.823 PS50158 ZF_CCHCZF_CCHC
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[106-204]T 2.1e-20 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[284-319]T 3.4e-05 G3D.4.10.60.10 no descriptionno description
PTHR10178[105-226]T 6.9e-15 PTHR10178 GAG/POL/ENV POLYPROTEIN[267-320]T 6.9e-15 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[105-226]T 6.9e-15 PTHR10178:SF12 POLYPROTEIN-RELATED[267-320]T 6.9e-15 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED
seg[222-233]? NA seg seg[255-267]? NA seg segseg
SSF57756[288-321]T 5.5e-06 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr08_finished_C08HBa0323O07.1.v1.seq_C08HBa0323O07.1

 

90.28

 

895

 

71

 

4

 

1

 

886

 

44664

 

43777

 

0

 

1076.0

 

AK248072

 

atagatgttcttgtgatgatgacttccagattttgggaaataatagttattgaattgatttttattaatgagtttaagtcttccgcattattttatgatgatattacattgaaatgttaaggtttagattggttggttcactcacataggagggtaagtgtgggtgccagtcgcggctcggttttgggtcgtgacaaacatggtatcagagcattaggttcgttggtctcatcacacaagaacgagtctagtagagtcttaaggaacggtagggggacgcctttacttttctttgagaggctacaagactttaggaaaattccattctttcatttcgtgctattacttggatacaattggtatctaggtgatacaaatttgtatctgaccatcttcactctgtttcacagatggttagaactagagcaacaactgcgccaacaccaacgtcggaaagacaagaagcgtccgagccagccactggggctgtagctcgaggaagagtagcggcaagatgccgtggtagaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccatctgatactagggcggtgactcctccaccaactgaggaagtggtaagagagggtggggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaattaggttctcgcttatcttagtgggttgtctgatcagggtcaggcccctccagtgttttctgcaccaacacctccgatttcagaggtacaacatgcagccactatggctcctcgtatggatgcctcattgtacataggcacgtttccacgtctgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatctgaggatatttacgattttctggttgactgtcatgagctactacacaagatgtgtatagtacaacggtttggtgttgagttcattagttataagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaatggaggcaccacctatgacttgggcctcattctctagcttgtttatggggaagtatatccctcggactttgagggataggaaaggggaagagttcttgagcctagagcaaggtaggatgtcggtcaatgcatatgaggctaagtttcgtgcactatccagatatgccactcaactttgtttcagtccacaagagcggattcgtcgttttgtgaaggggttgaggtcagaattgcggatttcagccttacaggtagcggctacggcaaaatccttccaagaagtggtagattttgtggtagaggtggaaggagtgaagccagatgaattcacaatggcatcgacatcaaagaggtttcgaaagggaggtgagtttaatggttcttactctagaggacagggttccggaggttactcagttcgtcccattcagtcttcactacagactgtagttgggggtccacctcagaccggtcaacacttctctgagagacctatgcttgactctagagagtgttatggatgtggggagactggacatattaggaggaattgtcccaaacagagttatagaccctcatagctagaggtagaggtggtcatggtagaggccgttattccggagaacgtggtggtcgaggtaatggtggacaccaaaacggcctaggtgatgggcaaactggagccactacatcacaacatggtaggagcaatggacagacaaacgatagggcccattgttacgctttccctgggcggtctgaagcggaggcatctgatgctgtcatcataggtaatcttctggtttgtgattgcatggcttctgtattgtttgatcct

 

6532

 

FC02BD09

1

ORF2

147

chr08_finished_C08HBa0197J17.1.v1.seq_C08HBa0197J17.1

416

0

825.0

AK224609

Show
FC02BD09

FC02BD09

 

1

 

ORF2

 

2097FE9D3526466A

 

147

 

IPR000617 | IPR003612

 

SEQUENCE: FC02BD09_1_ORF2CRC64: 2097FE9D3526466ALENGTH: 147 aa
InterPro
IPR000617
Family
Napin/ Bra allergen
PR00496[45-66]T 2.7e-07 PR00496 NAPIN[117-131]T 2.7e-07 PR00496 NAPINNAPIN
InterPro
IPR003612
Domain
Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor
PF00234[46-138]T 0.00046 PF00234 Tryp_alpha_amylTryp_alpha_amyl
SM00499[46-138]T 2.4e-07 SM00499 no descriptionno description
noIPR
unintegrated
unintegrated
G3D.1.10.120.10[40-140]T 1e-20 G3D.1.10.120.10 no descriptionno description
seg[42-63]? NA seg segseg
SSF47699[42-142]T 6.2e-15 SSF47699 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albuminBifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin

 

chr08_finished_C08HBa0197J17.1.v1.seq_C08HBa0197J17.1

 

100.0

 

416

 

0

 

0

 

225

 

640

 

21067

 

20652

 

0

 

825.0

 

AK224609

 

tcatagaataaacatctcacatcttttcattaatcatcatcatcataataacaaaaaaagagaagtatataattaaaaatcatgggtaaaactatgatagttggagccatttctttagccatccttttcatggcagccacagtttgtagctcacgtatcatgaccatcaccattgctgaagatgctcttaaccctcaaactcaaagctgccagcagcaatttcaacaggcacagcagctacgttcatgccagcagtttctaaggcagaggagccagcagtacgaggaccaacagattcctcgtgatgttcaacaatgttgcaatcagcttgaacagatacaagacccacaatgccgttgcgagggactcatgaaagtggttcaacaagaggaacaaaccgggaaagttcaaggaagacaaaggcaacagatgcttcaaactgcagagaatttgcctggtttatgtagacttagcccacaacgatgtgagatccaaactgttcgcagcttcttttaatttgcaaaaattatttgtaagcctgcgttcgcttataaataaataaatgatctagttgttgtaaaactcgatcgtagtaataaaataaaatcacaccttctggtgtgatttttctctcattgcaaaaaaaaaa

 

1

 

LEFL2054M05

1

ORF4

204

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

1397

0

1556.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

89.12

 

1397

 

151

 

1

 

6

 

1401

 

15800

 

14404

 

0

 

1556.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6738

 

LEFL2017I19

2

ORF2

235

chr06_unfinished_C06HBa0024L21.1.v1.seq_C06HBa0024L21.1-1

872

0

1316.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF2

 

164EB2CDA2E3381E

 

235

 

IPR005162

 

SEQUENCE: LEFL2017I19_2_ORF2CRC64: 164EB2CDA2E3381ELENGTH: 235 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[95-193]T 6.6e-25 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[53-218]T 9.6e-15 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[53-218]T 9.6e-15 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0024L21.1.v1.seq_C06HBa0024L21.1-1

 

94.04

 

872

 

52

 

0

 

2

 

873

 

3647

 

4518

 

0

 

1316.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5349

 

LEFL2052M19

3

ORF3

321

chr08_finished_C08HBa0027D09.1.v2.seq_C08HBa0027D09.1

1813

0

2286.0

AK248072

Show
LEFL2052M19

LEFL2052M19

 

3

 

ORF3

 

EA2FB960723E27D1

 

321

 

IPR001878 | IPR005162

 

SEQUENCE: LEFL2052M19_3_ORF3CRC64: EA2FB960723E27D1LENGTH: 321 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[298-307]T 0.18 PR00939 C2HCZNFINGER[307-315]T 0.18 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[298-315]T 5.8e-06 PF00098 zf-CCHCzf-CCHC
SM00343[299-315]T 0.00044 SM00343 no descriptionno description
PS50158[300-315]T 10.823 PS50158 ZF_CCHCZF_CCHC
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[106-204]T 2.1e-20 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[284-319]T 3.4e-05 G3D.4.10.60.10 no descriptionno description
PTHR10178[105-226]T 6.9e-15 PTHR10178 GAG/POL/ENV POLYPROTEIN[267-320]T 6.9e-15 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[105-226]T 6.9e-15 PTHR10178:SF12 POLYPROTEIN-RELATED[267-320]T 6.9e-15 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED
seg[222-233]? NA seg seg[255-267]? NA seg segseg
SSF57756[288-321]T 5.5e-06 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr08_finished_C08HBa0027D09.1.v2.seq_C08HBa0027D09.1

 

91.01

 

1813

 

151

 

4

 

121

 

1922

 

36783

 

38594

 

0

 

2286.0

 

AK248072

 

atagatgttcttgtgatgatgacttccagattttgggaaataatagttattgaattgatttttattaatgagtttaagtcttccgcattattttatgatgatattacattgaaatgttaaggtttagattggttggttcactcacataggagggtaagtgtgggtgccagtcgcggctcggttttgggtcgtgacaaacatggtatcagagcattaggttcgttggtctcatcacacaagaacgagtctagtagagtcttaaggaacggtagggggacgcctttacttttctttgagaggctacaagactttaggaaaattccattctttcatttcgtgctattacttggatacaattggtatctaggtgatacaaatttgtatctgaccatcttcactctgtttcacagatggttagaactagagcaacaactgcgccaacaccaacgtcggaaagacaagaagcgtccgagccagccactggggctgtagctcgaggaagagtagcggcaagatgccgtggtagaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccatctgatactagggcggtgactcctccaccaactgaggaagtggtaagagagggtggggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaattaggttctcgcttatcttagtgggttgtctgatcagggtcaggcccctccagtgttttctgcaccaacacctccgatttcagaggtacaacatgcagccactatggctcctcgtatggatgcctcattgtacataggcacgtttccacgtctgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatctgaggatatttacgattttctggttgactgtcatgagctactacacaagatgtgtatagtacaacggtttggtgttgagttcattagttataagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaatggaggcaccacctatgacttgggcctcattctctagcttgtttatggggaagtatatccctcggactttgagggataggaaaggggaagagttcttgagcctagagcaaggtaggatgtcggtcaatgcatatgaggctaagtttcgtgcactatccagatatgccactcaactttgtttcagtccacaagagcggattcgtcgttttgtgaaggggttgaggtcagaattgcggatttcagccttacaggtagcggctacggcaaaatccttccaagaagtggtagattttgtggtagaggtggaaggagtgaagccagatgaattcacaatggcatcgacatcaaagaggtttcgaaagggaggtgagtttaatggttcttactctagaggacagggttccggaggttactcagttcgtcccattcagtcttcactacagactgtagttgggggtccacctcagaccggtcaacacttctctgagagacctatgcttgactctagagagtgttatggatgtggggagactggacatattaggaggaattgtcccaaacagagttatagaccctcatagctagaggtagaggtggtcatggtagaggccgttattccggagaacgtggtggtcgaggtaatggtggacaccaaaacggcctaggtgatgggcaaactggagccactacatcacaacatggtaggagcaatggacagacaaacgatagggcccattgttacgctttccctgggcggtctgaagcggaggcatctgatgctgtcatcataggtaatcttctggtttgtgattgcatggcttctgtattgtttgatcct

 

6559

 

FC03AD05

1

ORF1

102

chr02_finished_C02HBa0180C05.1.v1.seq_C02HBa0180C05.1

452

0

896.0

AK224621

Show
FC03AD05

FC03AD05

 

1

 

ORF1

 

09AA504CDC692D04

 

102

 

IPR003612

 

SEQUENCE: FC03AD05_1_ORF1CRC64: 09AA504CDC692D04LENGTH: 102 aa
InterPro
IPR003612
Domain
Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor
PF00234[37-102]T 3.3e-14 PF00234 Tryp_alpha_amylTryp_alpha_amyl
SM00499[37-102]T 9.5e-05 SM00499 no descriptionno description
noIPR
unintegrated
unintegrated
G3D.1.10.110.10[32-101]T 8.1e-06 G3D.1.10.110.10 no descriptionno description
SSF47699[36-102]T 3.2e-17 SSF47699 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albuminBifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin

 

chr02_finished_C02HBa0180C05.1.v1.seq_C02HBa0180C05.1

 

100.0

 

452

 

0

 

0

 

1

 

452

 

14359

 

13908

 

0

 

896.0

 

AK224621

 

tataatttaaattgtataatgaaaatgactaaggtttgttcttttgtggcagtaatgttggtgatgatccttgtttgtgatcaatttggggctaacgaggcggcgacatgcagcgcctcgcagctgagcccgtgtttgggtgcgatccagggtgggaccgcaccatcacaggattgttgtgctaggcttaagaaccagcagccttgcatttgtggatttatgaaggatcctaatttgaggcaatatgttaattctccaaatgctaggaaagttgctggacaatgtggtgtaagcattcctagttgttaattaggtttacaacattttacttgttgtatacatatgggtcttatgtattatggaaaaaaatatatatatgtaagactttaaataaaaaatggttgtaatctgtgttcaagtgtgttatgatgaatgaatcttgtggcttttgaaaaaaaaaa

 

8

 

LEFL2052M19

3

ORF3

321

chr08_finished_C08HBa0323O07.1.v1.seq_C08HBa0323O07.1

1888

0

2446.0

AK248072

Show
LEFL2052M19

LEFL2052M19

 

3

 

ORF3

 

EA2FB960723E27D1

 

321

 

IPR001878 | IPR005162

 

SEQUENCE: LEFL2052M19_3_ORF3CRC64: EA2FB960723E27D1LENGTH: 321 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PRINTSPR00939C2HCZNFINGER
 0.18 [298-307]T  0.18 [307-315]T   
PFAMPF00098zf-CCHC
 5.8e-06 [298-315]T    
SMARTSM00343no description
 0.00044 [299-315]T    
PROFILEPS50158ZF_CCHC
 10.823 [300-315]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsMolecular Function: nucleic acid binding (GO:0003676)
Molecular Function: zinc ion binding (GO:0008270)
InterPro
IPR005162
Family
Retrotransposon gag protein
PFAMPF03732Retrotrans_gag
 2.1e-20 [106-204]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
GENE3DG3D.4.10.60.10no description
 3.4e-05 [284-319]T    
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 6.9e-15 [105-226]T  6.9e-15 [267-320]T   
PANTHERPTHR10178:SF12POLYPROTEIN-RELATED
 6.9e-15 [105-226]T  6.9e-15 [267-320]T   
SEGsegseg
 NA [222-233]?  NA [255-267]?   
SUPERFAMILYSSF57756Retrovirus zinc finger-like domains
 5.5e-06 [288-321]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr08_finished_C08HBa0323O07.1.v1.seq_C08HBa0323O07.1

 

91.53

 

1888

 

149

 

5

 

45

 

1923

 

148833

 

150718

 

0

 

2446.0

 

AK248072

 

atagatgttcttgtgatgatgacttccagattttgggaaataatagttattgaattgatttttattaatgagtttaagtcttccgcattattttatgatgatattacattgaaatgttaaggtttagattggttggttcactcacataggagggtaagtgtgggtgccagtcgcggctcggttttgggtcgtgacaaacatggtatcagagcattaggttcgttggtctcatcacacaagaacgagtctagtagagtcttaaggaacggtagggggacgcctttacttttctttgagaggctacaagactttaggaaaattccattctttcatttcgtgctattacttggatacaattggtatctaggtgatacaaatttgtatctgaccatcttcactctgtttcacagatggttagaactagagcaacaactgcgccaacaccaacgtcggaaagacaagaagcgtccgagccagccactggggctgtagctcgaggaagagtagcggcaagatgccgtggtagaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccatctgatactagggcggtgactcctccaccaactgaggaagtggtaagagagggtggggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaattaggttctcgcttatcttagtgggttgtctgatcagggtcaggcccctccagtgttttctgcaccaacacctccgatttcagaggtacaacatgcagccactatggctcctcgtatggatgcctcattgtacataggcacgtttccacgtctgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatctgaggatatttacgattttctggttgactgtcatgagctactacacaagatgtgtatagtacaacggtttggtgttgagttcattagttataagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaatggaggcaccacctatgacttgggcctcattctctagcttgtttatggggaagtatatccctcggactttgagggataggaaaggggaagagttcttgagcctagagcaaggtaggatgtcggtcaatgcatatgaggctaagtttcgtgcactatccagatatgccactcaactttgtttcagtccacaagagcggattcgtcgttttgtgaaggggttgaggtcagaattgcggatttcagccttacaggtagcggctacggcaaaatccttccaagaagtggtagattttgtggtagaggtggaaggagtgaagccagatgaattcacaatggcatcgacatcaaagaggtttcgaaagggaggtgagtttaatggttcttactctagaggacagggttccggaggttactcagttcgtcccattcagtcttcactacagactgtagttgggggtccacctcagaccggtcaacacttctctgagagacctatgcttgactctagagagtgttatggatgtggggagactggacatattaggaggaattgtcccaaacagagttatagaccctcatagctagaggtagaggtggtcatggtagaggccgttattccggagaacgtggtggtcgaggtaatggtggacaccaaaacggcctaggtgatgggcaaactggagccactacatcacaacatggtaggagcaatggacagacaaacgatagggcccattgttacgctttccctgggcggtctgaagcggaggcatctgatgctgtcatcataggtaatcttctggtttgtgattgcatggcttctgtattgtttgatcct

 

6530

 

LEFL2016F16

2

ORF1

329

chr08_finished_C08HBa0074N03.1.v1.seq_C08HBa0074N03.1

1407

0

1988.0

AK247997

Show
LEFL2016F16

LEFL2016F16

 

2

 

ORF1

 

B03F66FFC4D71D43

 

329

 

IPR005162

 

SEQUENCE: LEFL2016F16_2_ORF1CRC64: B03F66FFC4D71D43LENGTH: 329 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[167-265]T 1.2e-22 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[117-286]T 3.7e-17 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[117-286]T 3.7e-17 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED
seg[1-15]? NA seg seg[31-49]? NA seg seg[283-294]? NA seg seg[316-328]? NA seg segseg

 

chr08_finished_C08HBa0074N03.1.v1.seq_C08HBa0074N03.1

 

92.82

 

1407

 

101

 

0

 

2

 

1408

 

67658

 

66252

 

0

 

1988.0

 

AK247997

 

ccgtggtagaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccgtctgatactagggcggtgactcccccaccgactgaggaagtggtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaaccttccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgatcagggtcaggcccctccagtgttttctgcaccaacacctccggtttcagaggtacaacatgcagccactatggctccccgcatggatgttccattggaaataggaacgtttcctcgtctgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatcagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacggaggcaccacctatgacttgggcctcattctctagcttgtttatggagaagtatatcccccggactttgttgggtaggaaaaaggatgagttcttgagcctagagcaaggtaggatgtcggtcaatgcatatgaggctaagtttcgtgcactatccagatatgccacccaactttgtttcagtccacaagagcggattcgtcgttttgtgaaggggttgaggtcagagttgcggatttcagccttacaggtagcggctacggcaaaatccttccaagaagtggtagatttcgtggtagaggtggaaggagtgaagccagatgaattcaccatggcatcgacattaaagaggtttcgaaagggaggtgagtttaatggttcttactctagaggacagggttccggaggttactcagtttgacccattcagtcttcactacagactgtagttgggggtccacctcagaccggtgaacacttctatgagagacctatgcttgactctagagagtgttatggatgtggggagactggacatattaggaggaattgtcccaaacagagttatagacccccaatagctagaggtagaggtggtcatggtagaggccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggccggggtgatgggaaaactggagccactacatcacaacatggtaggggcagcggacaaacaaacgaaagagcccattgttatgctttccctgggtagtctgaagcggaggcatctgatgttgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatcct

 

5172

 

LEFL2054M05

1

ORF4

204

chr08_finished_C08HBa0323O07.1.v1.seq_C08HBa0323O07.1

1406

0

2074.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PRINTSPR00939C2HCZNFINGER
 0.15 [94-103]T  0.15 [103-111]T   
PFAMPF00098zf-CCHC
 3.6e-05 [94-111]T    
SMARTSM00343no description
 0.0046 [95-111]T    
PROFILEPS50158ZF_CCHC
 10.477 [96-111]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsMolecular Function: nucleic acid binding (GO:0003676)
Molecular Function: zinc ion binding (GO:0008270)
noIPR
unintegrated
unintegrated
GENE3DG3D.4.10.60.10no description
 6.4e-05 [80-115]T    
SEGsegseg
 NA [120-152]?    
SUPERFAMILYSSF57756Retrovirus zinc finger-like domains
 1.4e-05 [84-120]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr08_finished_C08HBa0323O07.1.v1.seq_C08HBa0323O07.1

 

93.67

 

1406

 

88

 

1

 

1

 

1405

 

149312

 

150717

 

0

 

2074.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6698

 

FC03AD05

1

ORF1

102

chr02_finished_C02HBa0134G09.1.v1.seq_C02HBa0134G09.1

452

0

896.0

AK224621

Show
FC03AD05

FC03AD05

 

1

 

ORF1

 

09AA504CDC692D04

 

102

 

IPR003612

 

SEQUENCE: FC03AD05_1_ORF1CRC64: 09AA504CDC692D04LENGTH: 102 aa
InterPro
IPR003612
Domain
Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor
PF00234[37-102]T 3.3e-14 PF00234 Tryp_alpha_amylTryp_alpha_amyl
SM00499[37-102]T 9.5e-05 SM00499 no descriptionno description
noIPR
unintegrated
unintegrated
G3D.1.10.110.10[32-101]T 8.1e-06 G3D.1.10.110.10 no descriptionno description
SSF47699[36-102]T 3.2e-17 SSF47699 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albuminBifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin

 

chr02_finished_C02HBa0134G09.1.v1.seq_C02HBa0134G09.1

 

100.0

 

452

 

0

 

0

 

1

 

452

 

6568

 

7019

 

0

 

896.0

 

AK224621

 

tataatttaaattgtataatgaaaatgactaaggtttgttcttttgtggcagtaatgttggtgatgatccttgtttgtgatcaatttggggctaacgaggcggcgacatgcagcgcctcgcagctgagcccgtgtttgggtgcgatccagggtgggaccgcaccatcacaggattgttgtgctaggcttaagaaccagcagccttgcatttgtggatttatgaaggatcctaatttgaggcaatatgttaattctccaaatgctaggaaagttgctggacaatgtggtgtaagcattcctagttgttaattaggtttacaacattttacttgttgtatacatatgggtcttatgtattatggaaaaaaatatatatatgtaagactttaaataaaaaatggttgtaatctgtgttcaagtgtgttatgatgaatgaatcttgtggcttttgaaaaaaaaaa

 

9

 

LEFL2054M05

1

ORF3

90

chr01_finished_C01HBa0256E08.2.v1.seq_C01HBa0256E08.2

1400

0

1610.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr01_finished_C01HBa0256E08.2.v1.seq_C01HBa0256E08.2

 

89.64

 

1400

 

143

 

2

 

8

 

1405

 

31143

 

32542

 

0

 

1610.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6725

 

LEFL2017I19

2

ORF3

78

chr06_unfinished_C06HBa0024L21.1.v1.seq_C06HBa0024L21.1-1

872

0

1316.0

AK248001

Show
LEFL2017I19

LEFL2017I19

 

2

 

ORF3

 

6433F915C5B41EDA

 

78

 

IPR000152

 

SEQUENCE: LEFL2017I19_2_ORF3CRC64: 6433F915C5B41EDALENGTH: 78 aa
InterPro
IPR000152
PTM
Aspartic acid and asparagine hydroxylation site
PS00010[9-20]? NA PS00010 ASX_HYDROXYLASX_HYDROXYL
noIPR
unintegrated
unintegrated
G3D.3.30.70.270[19-78]T 5.1e-09 G3D.3.30.70.270 no descriptionno description
PTHR10178[28-78]T 9.9e-19 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF14[28-78]T 9.9e-19 PTHR10178:SF14 RETROVIRUS POLYPROTEINRETROVIRUS POLYPROTEIN
SSF56672[19-78]T 2.4e-10 SSF56672 DNA/RNA polymerasesDNA/RNA polymerases

 

chr06_unfinished_C06HBa0024L21.1.v1.seq_C06HBa0024L21.1-1

 

94.04

 

872

 

52

 

0

 

2

 

873

 

3647

 

4518

 

0

 

1316.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5350

 

LEFL2054M05

1

ORF3

90

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

980

0

660.0

AK248077

Show
LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

83.67

 

980

 

157

 

2

 

74

 

1052

 

21712

 

22689

 

0

 

660.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6743

 

FC02DE02

3

ORF1

278

chr02_finished_C02HBa0160F05.1.v1.seq_C02HBa0160F05.1

605

0

906.0

AK246180

Show
FC02DE02

FC02DE02

 

3

 

ORF1

 

98ED7B3B8FA6261C

 

278

 

IPR000876 | IPR002942 | IPR005824 | IPR006646 | IPR013843 | IPR013844 | IPR013845

 

SEQUENCE: FC02DE02_3_ORF1CRC64: 98ED7B3B8FA6261CLENGTH: 278 aa
InterPro
IPR000876
Family
Ribosomal protein S4E
PIRSF002116[15-255]T 1.9e-127 PIRSF002116 Ribosomal protein S4Ribosomal protein S4
PTHR11581[16-277]T 2.3e-196 PTHR11581 30S/40S RIBOSOMAL PROTEIN S430S/40S RIBOSOMAL PROTEIN S4
InterPro
IPR002942
Domain
RNA-binding S4
PF01479[56-104]T 0.00055 PF01479 S4S4
SM00363[57-120]T 0.0054 SM00363 no descriptionno description
PS50889[56-115]T 8.987 PS50889 S4S4
InterPro
IPR005824
Domain
KOW
PF00467[189-225]T 3.2e-08 PF00467 KOWKOW
InterPro
IPR006646
Domain
KOW (Kyrpides, Ouzounis, Woese) motif
SM00739[188-215]T 0.0031 SM00739 no descriptionno description
InterPro
IPR013843
Domain
Ribosomal protein S4E, N-terminal
PF08071[17-54]T 4.1e-22 PF08071 RS4NTRS4NT
PS00528[22-36]T 8e-5 PS00528 RIBOSOMAL_S4ERIBOSOMAL_S4E
InterPro
IPR013844
Domain
Ribosomal protein S4E, N-terminal and RNA-binding
PD002667[15-129]T 2e-60 PD002667 RS4_SOLTU_P46300;RS4_SOLTU_P46300;
InterPro
IPR013845
Domain
Ribosomal protein S4E, central
PF00900[108-184]T 9.8e-44 PF00900 Ribosomal_S4eRibosomal_S4e
noIPR
unintegrated
unintegrated
PTHR11581:SF1[16-277]T 2.3e-196 PTHR11581:SF1 40S RIBOSOMAL PROTEIN S440S RIBOSOMAL PROTEIN S4
SSF55174[13-173]T 1.4e-31 SSF55174 Alpha-L RNA-binding motifAlpha-L RNA-binding motif

 

chr02_finished_C02HBa0160F05.1.v1.seq_C02HBa0160F05.1

 

94.05

 

605

 

35

 

1

 

403

 

1006

 

121791

 

122395

 

0

 

906.0

 

AK246180

 

gttgccgtcactcgccgcagttaatcagtcgggaaaccgccaaaatggcaagagggttgaagaaacatttgaagaggctcaatgcgcctaagcattggatgcttgataaacttggaggtgcttttgctcccaagccttcttctggtccacataaatcaagggaatgtttgccattggttattatcctgaggaacaggttgaaatatgcgttgacgtaccgtgaggtcatttctatcttgatgcaacgccaagttatggttgatgggaaagttagaacagataagacttaccctgctggtttcatggatgttgttactattccaaagacaaatgagagcttccgacttctttatgacactaagggtcggttccgcctccactcactcagagacgaggaagccaagttcaaactttgcaaggttcgatcagtccagtttggacagaagggtatcccatatctcaacacatatgatggaagaacaatccgctaccctgatcccctcatcaaggccaatgacaccatcaagctggacttagattccaataagattgttgacttcatcaagtttgatgttggtaatgtggttatggttactggtggtagaaacaggggacgtgttggaattcttaagaatagagagaagcacaagggtagctttgagacagttcacattcaggattccctggggcatgagttcgctacccgtttggggaatgtgttcactcttggtaaaggtagtaagccatgggtgtctttacctaagggtaaaggtatcaagttatctattattgaagaggctcgcaagaggatggctgctcaatcagctacaactgcttaataatcataggttgaacttgagattaatttaatagatttggtcatttttctctttgtttagagggatgccgttcttattttttgtgttgcatttcaacatctgtgtacttggtactattttacatacctttttttgtcaggaaaaaagaaagactcagttgagatcaaaaaaaaaaaaaaaaaaaa

 

530

 

LEFL2052M19

3

ORF3

321

chr08_finished_C08HBa0027D09.1.v2.seq_C08HBa0027D09.1

1457

0

1425.0

AK248072

Show
LEFL2052M19

LEFL2052M19

 

3

 

ORF3

 

EA2FB960723E27D1

 

321

 

IPR001878 | IPR005162

 

SEQUENCE: LEFL2052M19_3_ORF3CRC64: EA2FB960723E27D1LENGTH: 321 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PRINTSPR00939C2HCZNFINGER
 0.18 [298-307]T  0.18 [307-315]T   
PFAMPF00098zf-CCHC
 5.8e-06 [298-315]T    
SMARTSM00343no description
 0.00044 [299-315]T    
PROFILEPS50158ZF_CCHC
 10.823 [300-315]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsMolecular Function: nucleic acid binding (GO:0003676)
Molecular Function: zinc ion binding (GO:0008270)
InterPro
IPR005162
Family
Retrotransposon gag protein
PFAMPF03732Retrotrans_gag
 2.1e-20 [106-204]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
GENE3DG3D.4.10.60.10no description
 3.4e-05 [284-319]T    
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 6.9e-15 [105-226]T  6.9e-15 [267-320]T   
PANTHERPTHR10178:SF12POLYPROTEIN-RELATED
 6.9e-15 [105-226]T  6.9e-15 [267-320]T   
SEGsegseg
 NA [222-233]?  NA [255-267]?   
SUPERFAMILYSSF57756Retrovirus zinc finger-like domains
 5.5e-06 [288-321]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr08_finished_C08HBa0027D09.1.v2.seq_C08HBa0027D09.1

 

87.44

 

1457

 

179

 

2

 

121

 

1574

 

34551

 

33096

 

0

 

1425.0

 

AK248072

 

atagatgttcttgtgatgatgacttccagattttgggaaataatagttattgaattgatttttattaatgagtttaagtcttccgcattattttatgatgatattacattgaaatgttaaggtttagattggttggttcactcacataggagggtaagtgtgggtgccagtcgcggctcggttttgggtcgtgacaaacatggtatcagagcattaggttcgttggtctcatcacacaagaacgagtctagtagagtcttaaggaacggtagggggacgcctttacttttctttgagaggctacaagactttaggaaaattccattctttcatttcgtgctattacttggatacaattggtatctaggtgatacaaatttgtatctgaccatcttcactctgtttcacagatggttagaactagagcaacaactgcgccaacaccaacgtcggaaagacaagaagcgtccgagccagccactggggctgtagctcgaggaagagtagcggcaagatgccgtggtagaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccatctgatactagggcggtgactcctccaccaactgaggaagtggtaagagagggtggggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaattaggttctcgcttatcttagtgggttgtctgatcagggtcaggcccctccagtgttttctgcaccaacacctccgatttcagaggtacaacatgcagccactatggctcctcgtatggatgcctcattgtacataggcacgtttccacgtctgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatctgaggatatttacgattttctggttgactgtcatgagctactacacaagatgtgtatagtacaacggtttggtgttgagttcattagttataagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaatggaggcaccacctatgacttgggcctcattctctagcttgtttatggggaagtatatccctcggactttgagggataggaaaggggaagagttcttgagcctagagcaaggtaggatgtcggtcaatgcatatgaggctaagtttcgtgcactatccagatatgccactcaactttgtttcagtccacaagagcggattcgtcgttttgtgaaggggttgaggtcagaattgcggatttcagccttacaggtagcggctacggcaaaatccttccaagaagtggtagattttgtggtagaggtggaaggagtgaagccagatgaattcacaatggcatcgacatcaaagaggtttcgaaagggaggtgagtttaatggttcttactctagaggacagggttccggaggttactcagttcgtcccattcagtcttcactacagactgtagttgggggtccacctcagaccggtcaacacttctctgagagacctatgcttgactctagagagtgttatggatgtggggagactggacatattaggaggaattgtcccaaacagagttatagaccctcatagctagaggtagaggtggtcatggtagaggccgttattccggagaacgtggtggtcgaggtaatggtggacaccaaaacggcctaggtgatgggcaaactggagccactacatcacaacatggtaggagcaatggacagacaaacgatagggcccattgttacgctttccctgggcggtctgaagcggaggcatctgatgctgtcatcataggtaatcttctggtttgtgattgcatggcttctgtattgtttgatcct

 

6563