LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PRINTSPR00939C2HCZNFINGER
 0.15 [94-103]T  0.15 [103-111]T   
PFAMPF00098zf-CCHC
 3.6e-05 [94-111]T    
SMARTSM00343no description
 0.0046 [95-111]T    
PROFILEPS50158ZF_CCHC
 10.477 [96-111]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsMolecular Function: nucleic acid binding (GO:0003676)
Molecular Function: zinc ion binding (GO:0008270)
noIPR
unintegrated
unintegrated
GENE3DG3D.4.10.60.10no description
 6.4e-05 [80-115]T    
SEGsegseg
 NA [120-152]?    
SUPERFAMILYSSF57756Retrovirus zinc finger-like domains
 1.4e-05 [84-120]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr08_finished_C08HBa0239G21.1.v1.seq_C08HBa0239G21.1

 

90.91

 

110

 

10

 

0

 

1294

 

1403

 

107236

 

107127

 

4E-32

 

139.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6770