LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr08_finished_C08HBa0239G21.1.v1.seq_C08HBa0239G21.1

 

90.91

 

110

 

10

 

0

 

1294

 

1403

 

107236

 

107127

 

4E-32

 

139.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6767