LEFL2054M05

LEFL2054M05

 

1

 

ORF4

 

3B6B1E78207117C2

 

204

 

IPR001878

 

SEQUENCE: LEFL2054M05_1_ORF4CRC64: 3B6B1E78207117C2LENGTH: 204 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[94-103]T 0.15 PR00939 C2HCZNFINGER[103-111]T 0.15 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[94-111]T 3.6e-05 PF00098 zf-CCHCzf-CCHC
SM00343[95-111]T 0.0046 SM00343 no descriptionno description
PS50158[96-111]T 10.477 PS50158 ZF_CCHCZF_CCHC
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[80-115]T 6.4e-05 G3D.4.10.60.10 no descriptionno description
seg[120-152]? NA seg segseg
SSF57756[84-120]T 1.4e-05 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr06_unfinished_C06HBa0153O03.1.v1.seq_C06HBa0153O03.1-1

 

89.12

 

1397

 

151

 

1

 

6

 

1401

 

15800

 

14404

 

0

 

1556.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6738