LEFL2054M05

LEFL2054M05

 

1

 

ORF3

 

1C50B5EE34BD55E5

 

90

 

IPR005162

 

SEQUENCE: LEFL2054M05_1_ORF3CRC64: 1C50B5EE34BD55E5LENGTH: 90 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[1-90]T 7.7e-17 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[1-71]T 3.2e-11 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[1-71]T 3.2e-11 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr01_finished_C01HBa0256E08.2.v1.seq_C01HBa0256E08.2

 

89.64

 

1400

 

143

 

2

 

8

 

1405

 

31143

 

32542

 

0

 

1610.0

 

AK248077

 

ccgttgtagaggtcgtgggaggacgtcctctaggggaagagggcgagcacctagcccatctgatactagggcagtgactcctccaccgactgaggaagtaataagagaagggaggatggggaaaatgaacaagtgcagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatcgcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcaccaacacctccagttttagaggtacaacatgcagccactatggctcctcgtatggatgcctcattagatataggcacgtttccacgtctgactactgggcctataatgacaagtgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtgacttatcagttttaagggaatgccaaaatgtggtggcggtcacatattgagtgtcaaccaatggaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaaggtaggatgtcggttaatgcttatgaggctaagttccgtgcactatccagatatgccactcaactctgtttcagtcctcaagagtggattcgccgatttgtgaaggggttgaggtaagaattgcggatttcggccttacaggtagcggcaacggcaaaatccttccaagaagtggtagactttgtaatagaagtggaaggagtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcctatgattgactccagagaatgttatggatgtggggagattggacatattaggaaaaattgtcccagacaaagttatagacccccaatagctagaggtagaggtggtcatggtagagaccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaatggcagaggtaatgggcaaactggggccactacatcacaacatggtaggggcaatggacagacaaacgatagggcccattgttacactttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattgcatggcttctgtattgtttgatctt

 

6725