LEFL2052M19

LEFL2052M19

 

3

 

ORF3

 

EA2FB960723E27D1

 

321

 

IPR001878 | IPR005162

 

SEQUENCE: LEFL2052M19_3_ORF3CRC64: EA2FB960723E27D1LENGTH: 321 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PRINTSPR00939C2HCZNFINGER
 0.18 [298-307]T  0.18 [307-315]T   
PFAMPF00098zf-CCHC
 5.8e-06 [298-315]T    
SMARTSM00343no description
 0.00044 [299-315]T    
PROFILEPS50158ZF_CCHC
 10.823 [300-315]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsMolecular Function: nucleic acid binding (GO:0003676)
Molecular Function: zinc ion binding (GO:0008270)
InterPro
IPR005162
Family
Retrotransposon gag protein
PFAMPF03732Retrotrans_gag
 2.1e-20 [106-204]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
GENE3DG3D.4.10.60.10no description
 3.4e-05 [284-319]T    
PANTHERPTHR10178GAG/POL/ENV POLYPROTEIN
 6.9e-15 [105-226]T  6.9e-15 [267-320]T   
PANTHERPTHR10178:SF12POLYPROTEIN-RELATED
 6.9e-15 [105-226]T  6.9e-15 [267-320]T   
SEGsegseg
 NA [222-233]?  NA [255-267]?   
SUPERFAMILYSSF57756Retrovirus zinc finger-like domains
 5.5e-06 [288-321]T    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr08_finished_C08HBa0027D09.1.v2.seq_C08HBa0027D09.1

 

87.44

 

1457

 

179

 

2

 

121

 

1574

 

34551

 

33096

 

0

 

1425.0

 

AK248072

 

atagatgttcttgtgatgatgacttccagattttgggaaataatagttattgaattgatttttattaatgagtttaagtcttccgcattattttatgatgatattacattgaaatgttaaggtttagattggttggttcactcacataggagggtaagtgtgggtgccagtcgcggctcggttttgggtcgtgacaaacatggtatcagagcattaggttcgttggtctcatcacacaagaacgagtctagtagagtcttaaggaacggtagggggacgcctttacttttctttgagaggctacaagactttaggaaaattccattctttcatttcgtgctattacttggatacaattggtatctaggtgatacaaatttgtatctgaccatcttcactctgtttcacagatggttagaactagagcaacaactgcgccaacaccaacgtcggaaagacaagaagcgtccgagccagccactggggctgtagctcgaggaagagtagcggcaagatgccgtggtagaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccatctgatactagggcggtgactcctccaccaactgaggaagtggtaagagagggtggggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaattaggttctcgcttatcttagtgggttgtctgatcagggtcaggcccctccagtgttttctgcaccaacacctccgatttcagaggtacaacatgcagccactatggctcctcgtatggatgcctcattgtacataggcacgtttccacgtctgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatctgaggatatttacgattttctggttgactgtcatgagctactacacaagatgtgtatagtacaacggtttggtgttgagttcattagttataagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaatggaggcaccacctatgacttgggcctcattctctagcttgtttatggggaagtatatccctcggactttgagggataggaaaggggaagagttcttgagcctagagcaaggtaggatgtcggtcaatgcatatgaggctaagtttcgtgcactatccagatatgccactcaactttgtttcagtccacaagagcggattcgtcgttttgtgaaggggttgaggtcagaattgcggatttcagccttacaggtagcggctacggcaaaatccttccaagaagtggtagattttgtggtagaggtggaaggagtgaagccagatgaattcacaatggcatcgacatcaaagaggtttcgaaagggaggtgagtttaatggttcttactctagaggacagggttccggaggttactcagttcgtcccattcagtcttcactacagactgtagttgggggtccacctcagaccggtcaacacttctctgagagacctatgcttgactctagagagtgttatggatgtggggagactggacatattaggaggaattgtcccaaacagagttatagaccctcatagctagaggtagaggtggtcatggtagaggccgttattccggagaacgtggtggtcgaggtaatggtggacaccaaaacggcctaggtgatgggcaaactggagccactacatcacaacatggtaggagcaatggacagacaaacgatagggcccattgttacgctttccctgggcggtctgaagcggaggcatctgatgctgtcatcataggtaatcttctggtttgtgattgcatggcttctgtattgtttgatcct

 

6563