LEFL2052M19

LEFL2052M19

 

3

 

ORF3

 

EA2FB960723E27D1

 

321

 

IPR001878 | IPR005162

 

SEQUENCE: LEFL2052M19_3_ORF3CRC64: EA2FB960723E27D1LENGTH: 321 aa
InterPro
IPR001878
Domain
Zinc finger, CCHC-type
PR00939[298-307]T 0.18 PR00939 C2HCZNFINGER[307-315]T 0.18 PR00939 C2HCZNFINGERC2HCZNFINGER
PF00098[298-315]T 5.8e-06 PF00098 zf-CCHCzf-CCHC
SM00343[299-315]T 0.00044 SM00343 no descriptionno description
PS50158[300-315]T 10.823 PS50158 ZF_CCHCZF_CCHC
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[106-204]T 2.1e-20 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
G3D.4.10.60.10[284-319]T 3.4e-05 G3D.4.10.60.10 no descriptionno description
PTHR10178[105-226]T 6.9e-15 PTHR10178 GAG/POL/ENV POLYPROTEIN[267-320]T 6.9e-15 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[105-226]T 6.9e-15 PTHR10178:SF12 POLYPROTEIN-RELATED[267-320]T 6.9e-15 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED
seg[222-233]? NA seg seg[255-267]? NA seg segseg
SSF57756[288-321]T 5.5e-06 SSF57756 Retrovirus zinc finger-like domainsRetrovirus zinc finger-like domains

 

chr08_finished_C08HBa0027D09.1.v2.seq_C08HBa0027D09.1

 

91.01

 

1813

 

151

 

4

 

121

 

1922

 

36783

 

38594

 

0

 

2286.0

 

AK248072

 

atagatgttcttgtgatgatgacttccagattttgggaaataatagttattgaattgatttttattaatgagtttaagtcttccgcattattttatgatgatattacattgaaatgttaaggtttagattggttggttcactcacataggagggtaagtgtgggtgccagtcgcggctcggttttgggtcgtgacaaacatggtatcagagcattaggttcgttggtctcatcacacaagaacgagtctagtagagtcttaaggaacggtagggggacgcctttacttttctttgagaggctacaagactttaggaaaattccattctttcatttcgtgctattacttggatacaattggtatctaggtgatacaaatttgtatctgaccatcttcactctgtttcacagatggttagaactagagcaacaactgcgccaacaccaacgtcggaaagacaagaagcgtccgagccagccactggggctgtagctcgaggaagagtagcggcaagatgccgtggtagaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccatctgatactagggcggtgactcctccaccaactgaggaagtggtaagagagggtggggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaattaggttctcgcttatcttagtgggttgtctgatcagggtcaggcccctccagtgttttctgcaccaacacctccgatttcagaggtacaacatgcagccactatggctcctcgtatggatgcctcattgtacataggcacgtttccacgtctgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccagtcttcaagggtgctgaatctgaggatatttacgattttctggttgactgtcatgagctactacacaagatgtgtatagtacaacggtttggtgttgagttcattagttataagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaatggaggcaccacctatgacttgggcctcattctctagcttgtttatggggaagtatatccctcggactttgagggataggaaaggggaagagttcttgagcctagagcaaggtaggatgtcggtcaatgcatatgaggctaagtttcgtgcactatccagatatgccactcaactttgtttcagtccacaagagcggattcgtcgttttgtgaaggggttgaggtcagaattgcggatttcagccttacaggtagcggctacggcaaaatccttccaagaagtggtagattttgtggtagaggtggaaggagtgaagccagatgaattcacaatggcatcgacatcaaagaggtttcgaaagggaggtgagtttaatggttcttactctagaggacagggttccggaggttactcagttcgtcccattcagtcttcactacagactgtagttgggggtccacctcagaccggtcaacacttctctgagagacctatgcttgactctagagagtgttatggatgtggggagactggacatattaggaggaattgtcccaaacagagttatagaccctcatagctagaggtagaggtggtcatggtagaggccgttattccggagaacgtggtggtcgaggtaatggtggacaccaaaacggcctaggtgatgggcaaactggagccactacatcacaacatggtaggagcaatggacagacaaacgatagggcccattgttacgctttccctgggcggtctgaagcggaggcatctgatgctgtcatcataggtaatcttctggtttgtgattgcatggcttctgtattgtttgatcct

 

6559