LEFL2048J17

LEFL2048J17

 

6

 

ORF2

 

D6BD0F8833881CAB

 

50

 

IPR001395

 

SEQUENCE: LEFL2048J17_6_ORF2CRC64: D6BD0F8833881CABLENGTH: 50 aa
InterPro
IPR001395
Family
Aldo/keto reductase
PS00062[28-45]? NA PS00062 ALDOKETO_REDUCTASE_2ALDOKETO_REDUCTASE_2

 

chr08_finished_C08HBa0027D09.1.v2.seq_C08HBa0027D09.1

 

89.61

 

1396

 

145

 

0

 

11

 

1406

 

37199

 

38594

 

0

 

1618.0

 

AK248059

 

ccgtggtggaggtcgtgggaggacgtcctctagaggaagaggacgagcacctagcccatctgatagtagggcagtgactcctccaccgactgaggaagtggtaagagagggtgaggaaggggagaatgaacaagtgtagaatgagggattgccaccccaacctaccccagagatgatcaatcaggttctcgcctatctcagtgggttgtctgatcaaggtcaggcacctccagtgttttctgcgccaacaccttcggtttcagaagtacaacatgcagccactatggctcctcgtatggatgcctcattggacataggcacatttccacgtttgactactgggcctataatgacaaatgatcagcatgaacttttcagtaagttcttgaaattgaaacctccggtcttcaagggtgctgaatcggaggatgcttatgattttctggttgactgtcacgagctactacacaagatgggtatagtagaacggtttggtgtggagtttgtaacttatcagtttcaagggaacaccaaaatgtggtggcggtcacatatcgagtgtcaaccaacagaggcaccacctatgacttgggcctcgttctctagcttgtttatggagaagtatatcccccggactttgagggataggaaaagggatgagttcctgagcctagagcaagggaggatgtcggttaaagcttatgaggctaagttccgtgcactatccagatatgccactcaattatgtttcagtccccaagagcgaattcgccggtttgtgaaggggttgaggtcagaattgcggatttcggccttacagatcgcggcaacggcaaaatccttccaagaggtggtagactttctgatagaagtggaaggggtgaagccagacgacttcaccacaacatcgacatcaaaaaggcttcgaaagggaggtgagtttaatggttcttacactagaggacagggttcgggaagttactcagtccgaccaattcagtcttcactacagactgtagttgggggaccacctcagaccggtcaacacttctccgaggggcatatgattgactccaaagaatgttatggatgtggggagattggacatattaggagaaattgtcccagaccaagttatagacccccaataactagaggtagaggtggtcatggtagaggccgttattctggaggacgtggtggtcgaggtaatggtggtcaccaaaacggccgaggtgatgggcaaactggagccactacatcacaacatggttggggcaacggacagacgaacgatagggcccattgttacgctttccctgggcggtctgaagcggaggcatctgatgctgtcatcacaggtaatcttctggtttgtgattttatggcttctgtattgtttgatcct

 

6303