FC02BH09

FC02BH09

 

1

 

ORF1

 

29E049265F8C2454

 

358

 

IPR006527 | IPR011043

 

SEQUENCE: FC02BH09_1_ORF1CRC64: 29E049265F8C2454LENGTH: 358 aa
InterPro
IPR006527
Domain
F-box associated type 1
TIGR01640[106-334]T 1.8e-06 TIGR01640 F_box_assoc_1: F-box protein interactioF_box_assoc_1: F-box protein interactio
InterPro
IPR011043
Domain
Galactose oxidase, central
SSF50965[56-236]T 0.00029 SSF50965 Galactose oxidase, central domainGalactose oxidase, central domain
noIPR
unintegrated
unintegrated
G3D.1.20.58.140[9-61]T 0.00028 G3D.1.20.58.140 no descriptionno description
SSF81383[12-55]T 5e-05 SSF81383 F-box domainF-box domain

 

chr02_finished_C02HBa0023N04.2.v1.seq_C02HBa0023N04.2

 

85.16

 

438

 

61

 

2

 

94

 

529

 

21309

 

21744

 

5E-93

 

341.0

 

AK224612

 

cgtggaaaaaggccagacagatctcttactgcgccgaataataagatgtatctggatcttaaggacatcatcagggaacactccctttcatttcttcctgccaaatcacttttcaaattcaacgctgtctgtagggactggaaactccagatttcgagtccattttttgctcatagtcagtcacttttttgtcgcagtacttcaggcttctttatccattcacttgatggttctccttctctcatacccatcgacccaagcttttgtggggtgccagatccattccttaagtttttgcccgagcctgttgaccttaggtcctcctcaaatggactgctttgctgccaaggtcgtgcagaggacaaggcctactacatatgtaatcctgttactcagcagtggaagaaacttccaaaatcaaatgtgaatcacggaccagatccagcaattgtgctcatatttgaaccatcattgctcaactttgtagctgagtataaaattatatgcgcttttccatccactgattttgctgatgcagttgagtttgatatctattcctccaaagcgaattcttgggaagttgctggggagatccattttggagctagagcaacacgtatgccaaaatcagggcttcatgtgaatggtgttgtttactggatgaccacttcaggtagtattcttgcttttgatctaacaaaggagaggtcacagctccttcaaaactatgattctcgtgggatcttgggggagtatagtggaaagctctgtaagatgaacgtttgtggtaattcaatcagtttaagcattttggataatgtccacacaaatacaatgcagatgggaagccaaaccaaaatgtgggcagtaaaaccgaaggttgttcttgacagtaaaattgttgggaatgcagcgggggactacacagctttacatgtcgacagtaatatgttggtggttcggagcttgggaaaagcctttttgtatgatttcaagtctcgtgcaacaaaatgcattcctggtgaatttcacaattcgagatgcttgccctatgtcaacagtttagtctctctctagtctctgcttgagctgcaacatccttgtttgaaatttctttcatgattaagtattttgcctattttatatttcatgttattattattttcaagtgacaatgtaggattatataatagcagtgaatatattgaacattcataaatattaagtttatttcataaaaaaaaaa

 

6