LEFL2017I19

LEFL2017I19

 

2

 

ORF3

 

6433F915C5B41EDA

 

78

 

IPR000152

 

SEQUENCE: LEFL2017I19_2_ORF3CRC64: 6433F915C5B41EDALENGTH: 78 aa
InterPro
IPR000152
PTM
Aspartic acid and asparagine hydroxylation site
PS00010[9-20]? NA PS00010 ASX_HYDROXYLASX_HYDROXYL
noIPR
unintegrated
unintegrated
G3D.3.30.70.270[19-78]T 5.1e-09 G3D.3.30.70.270 no descriptionno description
PTHR10178[28-78]T 9.9e-19 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF14[28-78]T 9.9e-19 PTHR10178:SF14 RETROVIRUS POLYPROTEINRETROVIRUS POLYPROTEIN
SSF56672[19-78]T 2.4e-10 SSF56672 DNA/RNA polymerasesDNA/RNA polymerases

 

chr06_unfinished_C06HBa0024L21.1.v1.seq_C06HBa0024L21.1-1

 

94.04

 

872

 

52

 

0

 

2

 

873

 

3647

 

4518

 

0

 

1316.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5350