LEFL2017I19

LEFL2017I19

 

2

 

ORF2

 

164EB2CDA2E3381E

 

235

 

IPR005162

 

SEQUENCE: LEFL2017I19_2_ORF2CRC64: 164EB2CDA2E3381ELENGTH: 235 aa
InterPro
IPR005162
Family
Retrotransposon gag protein
PF03732[95-193]T 6.6e-25 PF03732 Retrotrans_gagRetrotrans_gag
noIPR
unintegrated
unintegrated
PTHR10178[53-218]T 9.6e-15 PTHR10178 GAG/POL/ENV POLYPROTEINGAG/POL/ENV POLYPROTEIN
PTHR10178:SF12[53-218]T 9.6e-15 PTHR10178:SF12 POLYPROTEIN-RELATEDPOLYPROTEIN-RELATED

 

chr06_unfinished_C06HBa0024L21.1.v1.seq_C06HBa0024L21.1-1

 

94.04

 

872

 

52

 

0

 

2

 

873

 

3647

 

4518

 

0

 

1316.0

 

AK248001

 

ccgtgggaggacgtcctcaagaagaagaggacaaacacctagcccatttgatgctagggcggtgactcctccaccgactgaggaagtagtaagagagggtgaggaaggggagaatgaacaagtgcaaaatgaggaattgccaccccaacctaccccagagatgatcaatcaggttctcgcttatcttagtgggttgtctgattagggtcaggcacctctagtgttttctacaccagcacctcagggtccgaaggtacaacatgcggctattgtggctccccgcatggatgccttatcggacataggcacgtttccacatctgattactgggcctataatgataaatgatcagcgtgaaattttcagtaagttcttaaaatttaaacctccagtcttcaagggtgctgaatctgaggatgcttacgattttctggttgactgtcatgagctactacacaagatgggtatagtagaacggtttggtgttgagttcgtgagttatgagtttcaagggaacgccaaaatgtggtggcggtcacatgttgagtgtcaaccaacagaggcaccacctatgacttgggcatcattctctagcttgtttatggagaagtatatccccccaactttgagggataggaaaagagatgagttcttgagcctagagcaaggtaggatgtcggttactgcatatgaggctaagtttcgtgcattatcaaggtatgccacccaactttgtttcagtccacaagagcggattcgccgttttgtgaaggggttgagatcagagttgcggatttcagccttacaggtagcggctacagcgaaatcctttcaagaagtggtggacttcgtgatagaggtagagggagtgaaaagcccaacttcaagagttgttgagcaaaggcttcattagaccaagtgcatctccttggggtgctccagttttgtttgtgaagaagaaggatgggagttttcggatgtgcatagactaccggcagttgaacaaggtaatcataaagaacaagtatcctcttcctcgcattgatgacttgttcgatcagttacaaggtgcttgtgtcttcactaagattgacttgagatccggttgtcatcaattgaaaatacgggcaacggatgtgccaaagactgcttttagaaccaggtatgggcattacgaatttgtagtgatgtcttttggtcttacgaatgcccctgctgcgttcatgagtttgatgaacgggattttaagccatatttggatctctttgtgatcgtatttattgatgatatactgatatactctaaaagtaaggaggaacatgaggagcatttgagaatggtattggaaatgttgagggagaaaaagctttatgccaagttctctaagtgttagttttggctagatgcagtgtccttcttggggcacgtggtttcta

 

5349