FC11CA08

FC11CA08

 

1

 

ORF2

 

7E384E5BDF142D67

 

213

 

IPR000167

 

SEQUENCE: FC11CA08_1_ORF2CRC64: 7E384E5BDF142D67LENGTH: 213 aa
InterPro
IPR000167
Family
Dehydrin
PF00257[35-212]T 3e-22 PF00257 DehydrinDehydrin
PS00823[150-157]T 8e-5 PS00823 DEHYDRIN_2[192-199]T 8e-5 PS00823 DEHYDRIN_2DEHYDRIN_2
noIPR
unintegrated
unintegrated
seg[40-77]? NA seg seg[83-119]? NA seg seg[164-182]? NA seg seg[205-212]? NA seg segseg

 

chr04_finished_C04SLm0096K04.1.v1.seq_C04SLm0096K04.1

 

100.0

 

592

 

0

 

0

 

282

 

873

 

62286

 

61695

 

0

 

1174.0

 

AK224734

 

tgataatatctttttgattgaaaaaaagaagaagaagtatggctgatcaatacgaacagaacaaggcatccgttgaagagactgttggtaccaacgtggaagctactgatcgtggtttgtttgatttcattggaaaaaaagaagaggaaaaaccaagtcatgctcatgaagaagaggcaatttcatctgagttgtctgaaaaagttaacgtaagtgaagaagtggaacccaaggaggaggaaaagaaacttcatcgatcaaatagcagctctagtagctccagtgatgaggaggaagaaattggagaggatggacagaagatcaagaagaagaaaaagaagggattgaaggataagattaaggaaaaaatatctggtgatcacaaggaagaatcgaaagcagaggatacctcagttccagttgagaaatacgaggaaacagaggagaaaaaaggatttctagacaaaattaaggagaaattgccaggtggcgggcataagaagacggaggaagtggcggcgccaccaccaccaccaccggctgcggtggagcatgaggcggaggggaaggagaagaagggatttttggacaaaattaaggagaaattaccaggataccactcaaaggctgaagaggaaaaggagaaggaaaaagactaaatgaaatgaaatgtttttttaattttacttttgggatgttatgattgtgtttctgtgttgttttggtttttaagtgtttttcatttccttcacttttgttttttttggattctgaaggataattgttagtactgtatttgatatttctgtatgtaagtgcatatgtatgtgccttatgtgtatgaagtttgataatatggatttgtaaaatgcaaaaaaaaaa

 

44