FC11BE03

FC11BE03

 

3

 

ORF2

 

FBA50DBDD3F1D747

 

101

 

IPR007667

 

SEQUENCE: FC11BE03_3_ORF2CRC64: FBA50DBDD3F1D747LENGTH: 101 aa
InterPro
IPR007667
Family
Hypoxia induced protein conserved region
PF04588[24-91]T 9.2e-20 PF04588 HIG_1_NHIG_1_N
noIPR
unintegrated
unintegrated
PTHR12297[41-99]T 7.3e-15 PTHR12297 HYPOXIA-INDUCBILE GENE 1 (HIG1)-RELATEDHYPOXIA-INDUCBILE GENE 1 (HIG1)-RELATED
PTHR12297:SF3[41-99]T 7.3e-15 PTHR12297:SF3 UNCHARACTERIZEDUNCHARACTERIZED

 

chr11_finished_C11HBa0323E19.1.v2.seq_C11HBa0323E19.1

 

100.0

 

443

 

0

 

0

 

156

 

598

 

134662

 

135104

 

0

 

878.0

 

AK224732

 

tcagacctcaaaatttcgactgaaaaagcagttacacaaagagaagagaagaagaacgaaaacaaataacgaagaaaattatgggatcgactgattcagaattggattcaatttttcaggataacaagcgtcatcgtaatcgtcttgttccgatcggtgcatttctcactgcaggagtgctcactgccggactcattagtttcaagcggggaaattctcaattaggtcagcaactaatgagagctagagttcttgttcaaggtggtacagtcgcactgatggttggttcagcatattactatggagataatttcaagcgcgctggatgactgactgactgactaccaaacgactccctcattcgtctgtcatgagttgattttctgctgggaaaaaatgattccatatcttgctaggatgcagtttctttacatggctgtcattgccaccccaatcacataagaaagaaaattagaggaaaaagtaataacagagtgaaacataatgctaatgtttatgtatttttcaaaatttatgggttcttgctttgtatctcatttgtgtcgttttaatctttatgttagttgaaattgattaaaaaaaaaa

 

42