FC10BA06

FC10BA06

 

2

 

ORF2

 

3C2D9B813FC766CE

 

98

 

IPR004926

 

SEQUENCE: FC10BA06_2_ORF2CRC64: 3C2D9B813FC766CELENGTH: 98 aa
InterPro
IPR004926
Family
Late embryogenesis abundant protein 3
PF03242[2-92]T 2.8e-55 PF03242 LEA_3LEA_3
noIPR
unintegrated
unintegrated
PD005577[2-94]T 7e-38 PD005577 Q42475_LYCES_Q42475;Q42475_LYCES_Q42475;
seg[30-44]? NA seg segseg

 

chr09_finished_C09HBa0278J12.1.v1.seq_C09HBa0278J12.1

 

100.0

 

220

 

0

 

0

 

1

 

220

 

56873

 

56654

 

6E-122

 

436.0

 

AK224722

 

ccctaagttcgccggagaaagagagtcgaagctacagaatttcagttcgccgctgcggaagctccatagccaaactccttccgccgcagcgttcttattcagaaattctcttgctccgactccgatctcgatatcataataagcaatggctcgttctttctctaactctaagactctctctgctttcgtctccgactccgtttctgcttttctcagcaggcgtggatatgcagcggcatcacaaggtgcagtttccggtgtagcaaaaggagtgccaaggagcaacgtgatgatgcaaaaaagtggagaggaatcggtgaagacttcatgggtgccagatccagttaccggttactataggccggaaggacaagcaaatgagattgacgctgctgagctccggaagatgctgttgaaacacagatctggaagcaactgaaaatctttgaagctgcgccgttgatctgcggttaatcatcggagattttcgatcaacgagaaaagagaatttagtgaaggaactgttttatcagaaaaatatagcagtgtgaaatttactcgtgctttgttgcttttaaattttaagcttattgttatatctttcttttattagtatcttttattcatgcaaatgaaataattatagtattaaaaaaaaaa

 

41